Aktuality Archive

Dlouhodobá perzistence antigenů  a DNA Borrelia burgdorferi   v tkáních pacientky s Lymskou nemocí

Dlouhodobá perzistence antigenů  a DNA Borrelia burgdorferi   v tkáních pacientky s Lymskou nemocí

Eva Sapi 1, *,Rumanah S. Kasliwala 1 , Hebo Ismail 1,Jason P. Torres 1 , Michael Oldakowski 1 , Sarah Markland 1 , Gauri Gaur 1 , Anthony Melillo 1 , Klaus Eisendle 2 , Kenneth B. Liegner 3,4,5 , Jenny Libien 6 a James E. Goldman 7

1Katedra biologie a ekologie, University of New Haven, West Haven, CT 06516, USA

2Centrální fakultní nemocnice Bolzano L Böhlerstr, 539100 Bolzano, Itálie

3Soukromá praxe, 592 Route 22, Suite 1B, Pawling, NY 12564, USA

4Northwell System, Northern Westchester Hospital, Mount Kisco, NY 10549, USA

5Health Quest System, Sharon Hospital, Sharon, CT 06069, USA

6Ústav patologie, Univerzita SUNY Downstate Health Sciences University, Brooklyn, NY 11203, USA

7Katedra patologie a buněčné biologie, Columbia University, New York, NY 10031, USA

*Autor, kterému by měla být korespondence adresována.

Antibiotics 2019 , 8 (4), 183; https://doi.org/10.3390/antibiotics8040183

Přijato: 22. srpna 2019 / Aktualizováno: 6. října 2019 / Přijato: 9. října 2019 / Zveřejněno: 11. října 2019

(Tento článek patří do Special Issue Antibiotics Resistance of Borrelia )

Stáhnout PDF          Procházet obrázky                    Zkontrolujte zprávy

Abstrakt

Zda bakterie Borrelia burgdorferi, původce lymské choroby, může v lidském těle přetrvávat po dlouhou dobu, byla doposud kontroverzní otázka. Cílem této studie bylo zjistit, zda bychom našli B. burgdorferi u pacienky s lymskou chorobou po dlouhém klinickém průběhu a po dlouhodobé léčbě antibiotiky. Zkoumali jsme tedy potenciální přítomnost B. burgdorferi, antigeny a DNA v lidských pitevních tkáních od pacientky s dobře dokumentovanou Lymskou chorobou v séru, PCR a prokázanou kultivačně. 53letá žena ze severního Westchester County v dolním regionu Hudson Valley v New Yorku byla během 16 let trvající nemoci opakovaně léčena rozsáhlou antibiotickou léčbou. Zajímali jsme se také, jakou formu by mohly mít borreliové organismy, zvláště v konfrontaci s nedávným zjištěním, že borrelie jsou schopny zaujímat agregovanou formu biofilmů rezistentních na antibiotika. Prověřili jsme také hostitelskou tkáň na přítomnost zánětlivých markerů, jako jsou CD3 + T lymfocyty. Řezy mozku, srdce, ledvin a jater pitvané tkáně byly analyzovány histologickými a imunohistochemickými metodami (IHC), konfokální mikroskopií, fluorescenční in situ hybridizací (FISH), polymerázovou řetězovou reakcí (PCR), a sekvenování celého genomu (WGS) / metagenomika. Ve všech orgánech pomocí IHC v kombinaci s konfokální mikroskopií jsme našli významné patologické změny, včetně borreliových spirochetálních shluků. Agregáty obsahovaly na svých površích dobře zavedený biofilmový marker, alginát, což naznačuje, že jsou skutečným biofilmem. Našli jsme DNA B. burgdorferi pomocí FISH, polymerázové řetězové reakce (PCR) a nezávislé ověření pomocí WGS / metagenomiky, což vedlo k detekci B. burgdorferi sensu stricto specifických DNA sekvencí. Analýza IHC ukázala významný počet infiltrujících CD3 + T lymfocytů přítomných vedle biofilmů B. burgdorferi . Souhrnně uvádíme několik důkazů, které naznačují, že B. burgdorferi může v lidském těle přetrvávat nejen ve spirochetální, ale i ve formě biofilmu rezistentního na antibiotika, a to i po dlouhodobé léčbě antibiotiky. Přítomnost infiltrujících lymfocytů v blízkosti biofilmů B. burgdorferi naznačuje, že organismy ve formě biofilmu mohou vyvolat chronický zánět.

Klíčová slova: Borrelia burgdorferi ; spirocheta ; Lymská borelióza ; persisters ; biofilmy ; odolnost proti antibiotikům

1. Úvod

Lymská borelióza, multisystémové onemocnění přenášené klíšťaty způsobené spirochetou Borrelia burgdorferi sensu lato, se stala velkým problémem v oblasti veřejného zdraví [ 1 , 2 , 3 , 4 , 5 ].  Léčba lymské choroby spočívá především v podávání antibiotik [ 6 , 7 , 8 ]. K recidivě onemocnění však často dochází s přetrvávajícími příznaky i po ukončení léčby, bez ohledu na volbu antibiotik [ 9 , 10 , 11 , 12 , 13 , 14]. Otázkou je, zda přetrvávající příznaky souvisejí s probíhající spirochetální infekcí navzdory antibiotické terapii [ 15 ]. Studie na zvířatech in vivo na imunokompetentních myších, psech a nehumánních modelech primátů identifikovaly přežívající, ale nikoli kultivovatelnou formu B. burgdorferi, která odolá léčbě antibiotiky [ 16 , 17 , 18 , 19 , 20 ]. Nedávné studie u makaků rhesus a myší potvrdily tato pozorování prokázáním metabolicky aktivní, přetrvávající B. burgdorferi po léčbě u zvířat přeléčených antibiotiky [ 20 , 21 , 22 , 2324 ]. Existují také studie na lidech, které poskytují klinický důkaz, že chronická forma lymské choroby může být způsobena přetrvávající spirochetální infekcí, což by vysvětlovalo přetrvávající příznaky [ 25 , 26 , 27 , 28 ].

Už dříve bylo předpokládáno, že formy Borrelia rezistentní na antibiotika mohou být způsobeny tvorbou alternativních morfologií, jako jsou „kulatá tělesa“ (cysta a granule), které byly poprvé identifikovány a studovány v 90. letech 20. století dr. Øysteinem Brorsonem a Alanem MacDonaldem [ 29 , 30 ]. Potenciálně účinná antimikrobiální léčba cystoidních forem [ 31 ] však nepřinesla lepší výsledky in vivo, což naznačuje, že by mohly existovat další alternativní formy poskytující útočiště před antibiotiky [ 32 ].

Jedna taková alternativní forma se nazývá biofilm. Bakteriální biofilmy jsou odpovědné za několik chronických onemocnění, jako je parodontitida, osteomyelitida, bakteriální endokarditida a dokonce i chronická plicní infekce u pacientů s cystickou fibrózou [ 33 , 34 , 35 , 36 , 37 ]. Organismy v biofilmech je obtížné odstranit, protože jejich rezistence na antibiotika může být až 1000krát větší než u jejich volně žijících forem [ 35 , 36 , 37]. Rezistence biofilmu je založena na mnoha mechanismech, jako je neúplná penetrace antibiotik do matrice, inaktivace antibiotik změněným mikroprostředím v biofilmu a vysoce chráněná rezistentní bakteriální populace [ 38 , 39 , 40 ]. V posledních několika letech jsme poskytli podstatné důkazy o tom, že B. burgdorferi sensu lato a stricto jsou skutečně schopny vytvářet biofilmy in vivo a in vitro [ 41 , 42 , 43]. Mnohé z důležitých rysů biofilmu, jako jsou strukturální přestavby v biofilmu a vývoj ochranných matric na povrchu, byly identifikovány nejen v kultivovaných spirochetách, ale také v biopsiích tkáně boreliálních lymfocytomů [ 41 , 42 , 43 ]. Specifické biofilmové markery, jako jsou charakteristické ochranné vrstvy obsahující alginát, extracelulární DNA a vápníkové kanály a výčnělky, lze nalézt v biofilmu Borrelia in vitro a in vivo [ 41 , 42 , 43 ]. Také jsme uvedli, že tvorba biofilmu B. burgdorferi dramaticky zvyšuje odolnost vůči antibiotikům [ 44 , 45 , 46]. Celkově tato pozorování silně naznačují, že tvorba biofilmu B. burgdorferi by mohla hrát významnou roli v jejich přežití v různých podmínkách prostředí tím, že poskytne útočiště pro jednotlivé buňky. Tvorba biofilmu B. burgdorferi by také mohla změnit způsob, jakým přemýšlíme o Lymské nemoci, zejména u pacientů, u nichž se zdá, že infekce přetrvává navzdory dlouhodobé léčbě antibiotiky.

Zde uvádíme pacientku se sérovou, PCR a kultivačně pozitivní lymskou boreliózou, která byla během 16 let podrobena rozsáhlé antibiotické léčbě. Pátrali jsme po tom, zda bychom po antibiotických terapiích našli důkaz o Borrelii, a pokud ano, jakou podobu by mohly organismy mít. Zkoumali jsme hypotézu, že antibiotikum-rezistentní formy B. burgdorferi mohou existovat v Borrelií-infikované lidské tkáni a že perzistentní infekce může být spojena s odpovídajícími patologickými nálezy. Proto jsme hodnotili pitevní tkáně od tohoto pacienta na na přítomnost borreliových spirochet a biofilmů pomocí imunohistochemických metod (IHC), fluorescenční in situ hybridizace (FISH), polymerázové řetězové reakce (PCR) a sekvenování celého genomu (WGS) ) / metagenomické metody. Dále byla studována přítomnost zánětlivých infiltrátů obsahujících CD3 + T buňky a jejich vztah k buňkám a agregátům pozitivním na Borrelia.

 

1.1. Klinická historie

39letá žena s nejméně dvouletou anamnézou spastické paraparézy, ochrnutí lebečních nervů a lymfocytární CSF pleocytózou byla poprvé vyšetřena jedním z autorů (KL) v roce 1989. Pacientka žila v klíšťaty zamořené chatové komunitě v severní části Westchester County v dolním regionu Hudson Valley ve státě New York, vysoce epidemická oblast pro lymskou boreliózu. Bydlela přechodně také v severní Kalifornii. Nebyla zaznamenána anamnéza migrujícího erytému. Důkladné vyšetření na infekci Boreliou Burgdorferi bylo zcela negativní. Splenektomie byla provedena pro idiopatickou trombocytopenickou purpuru v roce 1976.

V dubnu 1990 byla empiricky léčena na lymskou boreliózu 21 dny intravenózního cefotaximu (2 g, každých 8 hodin). Pleocytóza mozkomíšního moku před a po léčbě se nezměnila, stejně jako její klinický stav. Po čtyřech měsících perorálního minocyklinu se nezlepšila. Postupně se stala uvázanou doma a na invalidním vozíku. Neměla žádné domácí mazlíčky. Je nepravděpodobné, že byla infikována v mezidobí mezi dubnem 1990 a prosincem 1991. CSF byla znovu vyšetřena v prosinci 1991 a odhalila lymfocytární pleocytózu. Míšní mok umístěný v médiu BSK-II a kultivovaný v Centru pro kontrolu nemocí (Fort Collins, CO, USA) vykázal o několik týdnů později růst spirochet, což bylo potvrzeno pomocí PCR jako B. burgdorferi. Další léčba byla „pulzní“ režim cefotaximu začínající v lednu 1992 (4 g, každých 8 × 3 po sobě jdoucích dávek, jednou týdně po dobu 13 týdnů). Zlepšení jejího klinického stava a schopnost chůze bylo jen skromné. Režim „pulsní“ byl zesílen (cefotaxim 4 g každých 8 hodin x 6 po sobě jdoucích dávek, týdně) po dobu 10 měsíců, ale její stav se pomalu zhoršoval. Intravenózní antibiotická terapie byla přerušena a byla převedena na Mayo Clinic (Rochester, MN, USA), aby zvážili zavedení baclofenové pumpy s ohledem na její spasticitu na dolních končetinách a na další názor ohledně managementu léčby. Testovací dávka baklofenu, i když snížila spasticitu, jí znemožnila stát nebo se jakkoli přemisťovat, takže tento přístup byl opuštěn. V lednu 1993 byla léčena 10 dny intravenózním ceftriaxonem i s ohledem na pozitivní ANA s vysokým titrem (1: 2560),

V květnu 1993 se jí nepodařilo udržet šálek, převrátit se na posteli nebo si vzpomenout na rozhovory, které se konaly o několik minut dříve. CT vyšetření hrudníku odhalilo pleuroperikardiální výpotky. Bylo vytvořeno perikardiální okno. Histologický preparát perikardu odhalil spirochety kompatibilní s Borrelia a histologie prokázala perikarditidu s infiltrací makrofágy, lymfocyty a plazmatickými buňkami. Barvení fykoerythrinu ukázalo spirochetálně kompatibilní struktury.

Léčba 109 nepřetržitými dny intravenózního cefotaximu (2 g, IV každých 8 hodin) vedla k dramatickému zlepšení encefalopatie a umožnila jí ambulantně pohybovat 500 stop pomocí pohyblivého chodítka. Pleuroperikardiální výpotky vymizely. Denní intravenózní intravenózní podávání cefotaximu pokračovalo další tři měsíce. V následujících měsících vysazní léčby začala být encefalopatická. Denní intravenózní cefotaxim byl znovu zaveden v říjnu 1994.

Neuropsychologické testování provedené před a po čtyřech měsících této léčby ukázalo mírné objektivní zlepšení kognitivní funkce. Tato pacientka byla před onemocněním vysoce oceňovanou pediatrickou sestrou intenzivní péče. V říjnu 1994 a znovu v únoru 1995 podstoupila formální podrobné neuropsychologické vyšetření, aby se vyhodnotil její kognitivní stav a dopad léčby, pokud existuje, čtyřměsíčním intravenózním cefotaximem (2 g každých 8 hodin). Na objektivních neuropsychologických testech prokázala výrazné nedostatky v paměti. Po léčbě prokázala mírné zlepšení vizuální paměti, zpožděné vyvolání verbální paměti a významně zvýšené skóre v pozornosti a koncentraci. Přes aplikovanou léčbu měla i nadále hluboké deficity v paměti.

Kvůli nedostatečné pojistce pacientky bylo zabrániněno další léčbě antibiotiky a její stav se zhoršil. Série vyšetření mozkomíšního moku odhalila variabilní pleocytózu. Lyme ELISA, která byla sérokonvertována v prosinci 1991, byla následně sérovariabilní a Western bloty, i když vykazovaly pruhy s vysokou specificitou pro lymskou chorobu, často nesplnily kritéria CDC pro pět z 10 CDC-specifických IgG pásů. DNA B. burgdorferi byla prokázána pomocí PCR v krvi pacientky několikrát v letech 1995 až 2001.

Léčba intravenózním ceftriaxonem (4 g, tři dny v týdnu), darovaná výrobcem na konci září 2000 a v polovině března 2001, s některými pauzami, celkem 36 podaných dávek, nepřinesla zjevný klinický přínos.

Po změně svého pojištění jí byl po dobu tří týdnů počínaje 27. květnem 2003 aplikován intravenózní cefotaxim 2 gramy třikrát denně po dobu tří týdnů, ale byl pozastaven, protože neexistoval mechanismus úhrady. Zatímco probíhaly pokusy o zajištění prostředků na úhradu ATB léčby, dne 6. července 2003 se stav zhoršil. Navzdory terapeutickým hladinám difenylhydantoinu pro záchvatovou poruchu, která se vyvinula dříve v průběhu její nemoci (počátek: květen 2000), prodělala řadu grand mal záchvatů a byla převezena sanitkou do místní nemocnice. Záchvaty byly kontrolovány úpravou antiepileptické terapie, ale vyvinula se těžko řešitelná hypotenze. Po diskuzi mezi nemocničními lékaři a nejbližšími příbuznými byl rozhodnuto o případném Do not Resuscitate. Krátce nato pacientka zemřela.

Případ pacientky do roku 1996 byl již dříve zveřejněn [ 11 , 47 , 48 ]. Podrobná dokumentace jejího případu, včetně korespondence týkající se její péče a okolností vedoucích k její smrti, byly zveřejněny [ 49 ].

2. Výsledky

2.1. Patologické nálezy – CNS a PNS

Mozkové leptomeningy obsahovaly infiltráty složené z chronických zánětlivých buněk, hlavně lymfocytů, plazmatických buněk a makrofágů ( obrázek 1 a). Řada meningálních cév byla uzavřena a rekanalizována ( obrázek 1 b), ale nebyly tam žádné akutně uzavřené cévy. Krevní cévy v kůře, v subkortikální bílé hmotě, bazálních gangliích a thalamu vykazovaly perivaskulární akumulaci lymfocytů a makrofágů, s řídce se vyskytujícími se plazmatickými buňkami ( obrázek 1 d), ale nebyla prokázána akutní vaskulitida. Parenchym obsahoval velké množství malých infarktů, které ovlivňovaly jak šedou, tak bílou hmotu hemisfér ( obrázek 1 c, e a obrázek 2)a, b). Přestože jsme zjistili tyto patologické rysy v mnoha oblastech hemisfér, nejvíce byly postiženy čelní kůra a subkortikální bílá hmota. V capsula interna byly přítomny infarkty, které vyvolaly degeneraci kortikospinálního traktu, vizualizovanou barvou Bielschowského stříbra míchy ( obrázek 2 d). Infarkty byly také přítomny v mozečku ( obrázek 2 c). Našli jsme chronické zánětlivé infiltráty kolem krevních cév v kraniálních nervech ( obrázek 2 e). V našich vzorcích nebyly žádné známky degenerace kraniálních nervů.

figure 1

Obrázek 1. Reprezentativní patologické obrazy CNS. ( ) Řez frontálních leptomeningů ukazuje meningeální zahušťování a chronické zánětlivé infiltráty. Penetrující cévy obklopuje infiltrát (šipka). ( B ) A leptomeningealní cévy, které byly uzavřeny, což ukazuje malé zóny rekanalizace. ( C ) Hlubší vrstvy frontální bílé hmoty obsahuje infarkty, zde jeden je znázorněn (*). ( D céva) Dále směs lymfocytů a plazmatických buněk. ( E ), s infarktem ve frontálním kortexu (*) v blízkosti krevní cévy chronický zánětlivý infiltrát (šipka). Všechny řezy byly obarveny pomocí H&E. Měřítko: a ) 100 μm, b) 25 μm, ( c ) 100 μm, ( d ) 25 μm, a ( e ) 200 μm.

figure 1

Obrázek 2. Reprezentativní patologické obrazy CNS a PNS. ( ) Část frontální mozkové kůry a leptomeningů (L) ukazuje zhuštěný, zánětlivý infiltrát mozkových blan a přilehlé kůry s infarkty (*). ( b ) Velký perivaskulární chronický zánětlivý infiltrát v putamenu (šipka). ( C ) s infarktem v mozečku bílé hmoty a kůry (*). Na levém okraji infarktu je céva s okolním chronickým zánětlivým infiltrátem. ( D ) A Bielschowsky barvení stříbrem z celého úseku příčného míchy jeví vážné, jednostranné kortikospinální dráhy degenerace, oba boční (**) a přední (*) plochy (Bielshowsky barvení stříbrem). ( e) Část lebečního nervu ukazuje chronický zánětlivý infiltrát spojený s malými cévami v perineuriu. Stupeň myelinizace okolních axonů se jeví jako normální. Pitevní tkáně jsou obarveny standardními histologickými barvivy H&E. Měřítko: ( a ‒ c ) 200 μm, ( e ) 25 μm.

figure 3

 

2.2. Patologické nálezy – ledviny / srdce / játra

Ledvina obsahovala mnoho ložisek infiltrátů lymfocytů a plazmatických buněk ( obrázek 3 ), zahrnujících jak kůru, tak i dřeň. Rozptýlené krevní cévy byly chronicky uzavřeny a glomeruly byly sklerotické ( obrázek 4 ). Kromě toho tam byly vláknité jizvy.

Obrázek 3. Reprezentativní patologické obrazy ledvin. Všechny řezy byly obarveny standardními histologickými barvivy H&E. ( ) Část A levé komory s rozsáhlými vláknité zjizvení (*). Měřítko: 200 μm. ( B ) Část ledvin ukazuje zánětlivé infiltráty (*) rozptýlené mezi glomerulů a kanálků a oblastí vláknitého jizev (**). Měřítko: 100 μm. ( C ) Část jater se zánětem v portální oblasti (*). Měřítko: 100 μm.

figure 3

Obrázek 4. Reprezentativní obrazy barvení CD3 v řezu CNS a tkáně ledvin. ( ) Část mozku, imunochemicky značeny na přítomnost T-buněk (CD3) s perivaskulárním infiltrátem a rozptýlené T buňky v parenchymu. ( b ) Řezy ledvin imunologicky obarvená na T buňky (CD3) ukazuje agregát T buněk a rozptýlené T buňky v tkáni. Měřítko: 100 μm.

figure 4

Sekce srdce levé a pravé komory zahrnovaly vláknité jizvy, které nahradily svalové svazky ( obrázek 3 a). Vyskytly se řídké perivaskulární chronické zánětlivé infiltráty (výsledky nejsou uvedeny). Část mitrální chlopně vykazovala fibrózu  (výsledky nejsou uvedeny).

Játra vykazovala výrazný portální lymfocytární zánět s tvorbou lymfoidních folikulů ( obrázek 3 ). Došlo k určitému rozšíření zánětu na periportální oblasti, ale zánětlivé shluky byly převážně lokalizovány do portálních zón. Neexistovala žádná nekróza a žádná významná fibróza.

 

2.3. Zánětlivé infiltráty

Immunostaining CNS, jater, ledvin a srdce s protilátkami CD3 a CD20 odhalily, že lymfocyty byly převážně T lymfocyty (CNS obrázek 4a , ledviny, obrázek 4b). Byly přítomny pouze vzácné B buňky (výsledky nejsou uvedeny).

figure 5

2.4. Výsledky IHC / FISH / Confocal Microscopy

Hodnotili jsme čtyři různé tkáně (srdce, ledviny, játra a mozek) na potenciální přítomnost antigenu Borrelia pomocí B. burgdorferi specifických metod IHC, FISH, PCR, WGS a metagenomiky. Pro zkoumání potenciální přítomnosti biofilmů Borrelia v těchto pitevních tkáních jsme také použili biofilm specifický marker, alginát, ve dvojím imunofluorescenčním barvení, jak bylo popsáno dříve [ 50 ]. Získané obrázky byly analyzovány fluorescenční a konfokální mikroskopií.

V první sadě experimentů IHC bylo 50 řezů z každého ze čtyř orgánů (mozek, srdce, ledviny a játra) imunologicky monoklonální protilátkou specifickou pro B. burgdorferi sensu stricto. Našli jsme důkazy pro spirochetální shluky a agregáty B. burgdorferi ve všech orgánech. ( Obrázek 5 , Panely A, E, I a M). Kromě toho jsme pomocí anti-alginátové protilátky zjistili důkazy o velkých agregátech podobných biofilmu ( obrázek 5 , panely A, E, I a K; zelené šipky) ve všech orgánech. Pro stanovení specificity protilátek byl nespecifický IgG použit jako negativní kontrola ve všech experimentech IHC ( obrázek 5), Panely C, G, K a O). Morfologie tkání byla vizualizována pomocí diferenciální interferenční kontrastní mikroskopie (DIC) ( obrázek 5 , panely D, H, L a P).

Obrázek 5. Reprezentativní snímky IHC barvení pitevních tkání (srdce, ledviny, játra, mozek) pomocí protilátek Borrelia a alginátu. Agregáty se barvily pozitivně Borrelia – (zelené barvení: A , E , I , M ) a protilátky specifické pro alginát (červené barvení: B , F , J , N ). Nespecifická protilátka IgG byla použita jako další negativní kontrola primárních protilátek pomocí sekvenční tkáňové řezy ( C , G , K , O). Diferenční interferenční mikroskopie (DIC) ukazující velikost a morfologii tkáně ( D , H , L , P ). Měřítko: 200 μm.

 

Abychom kvantifikovali naše nálezy IHC, dále jsme zkoumali další po sobě jdoucí sekce z každého ze čtyř orgánů pro počet a velikost biofilmů B. burgdorferi ( tabulka 1)). Celkem bylo imunofarbeno 250 řezů mozkové tkáně, jak je popsáno výše; výsledky ukázaly 0–4 biofilmy na sklíčko v rozmezí od 20 do 150 µm. V srdečních řezech (155) jsme zjistili, že každá sekce obsahovala 0–6 biofilmů, s velikostmi v rozmezí 20–100 µm. Řezy tkáně ledvin (165) obsahovaly 0–4 biofilmů / řez v rozsahu 20–200 µm. Největší a největší počet biofilmů jsme našli v 180 jaterních řezech s 0–7 biofilmy / řez v rozmezí 20–300 µm. Statistické analýzy počtu struktur biofilmu v různých orgánech však neprokázaly žádné významné rozdíly. ( hodnoty p > 0,05)

 

Tabulka 1. Kvantitativní analýza experimentů IHC na biofilmech Borrelia v mozku, srdci, ledvinách a játrech. SD = směrodatná odchylka.

Orgán Počet IHC obarvených sklíček Počet biofilmů na snímek ± SD Velikost biofilmu (µm)
Mozek 250 0–4 ± 1,2 20–150
Srdce 155 0–6 ± 1,5 20–100
Ledviny 165 0–4 ± 1,1 20–200
Játra 180 0–7 ± 1,6 20–300

 

Obrázky S1 – S4 poskytují více příkladů biofilmových struktur pozitivních na B. burgdorferi / alginát v mozkové, srdeční, ledvinové a jaterní tkáni. Do těchto experimentů jsme zahrnuli další kontroly, abychom zajistili specifičnost našich IHC postupů. Například jsme provedli alginát IHC na po sobě jdoucích sklíčcích, abychom demonstrovali nezávislé barvení Borrelia a alginátu na stejném biofilmu. Kromě nespecifické IgG negativní kontroly jsme kromě toho zahrnuli také pitevní tkáně mozku, srdce, ledvin a jater od pacientů ve věku podobném bez patologických změn v žádném z těchto orgánů. Tyto řezy tkáně pitevní tkáně negativní kontroly byly imunologicky obarveny na B. burgdorferi/ alginát podle stejného postupu IHC a nevykazovaly žádné pozitivní barvení ani na B. burgdorferi, ani na alginátové antigeny ( obrázky S1 – S4 , panely I, J). Kromě toho jsme zakoupili komerčně dostupné sklíčka zdravé tkáně pro všechny čtyři orgány (20 sklíček / každý) a imunobarvili jsme je na antigeny B. burgdorferi a alginát a nenašli jsme žádný důkaz o pozitivním barvení na B. burgdorferi a alginátové antigeny v těchto tkáňových řezech (není zobrazeno). Jako nezávislé ověření experimentů IHC byly mozkové řezy z případu odeslány do zdravotnického centra v Innsbrucku (Innsbruck, Rakousko) a IHC bylo provedeno, jak bylo popsáno dříve [ 50 ]. Obrázek S5 ukazuje reprezentativní obrázek IHC barvení mozkové tkáně pro B. burgdorferi (červené barvení červenými šipkami).

figure 6

Rovněž byla zkoumána prostorová distribuce barvení alginátu v srdeční tkáni pozitivní na spirochetální i agregované formy B.B. Obrázek 6 ukazuje, že spirochetové shluky pozitivní na Borrelia (zelené zabarvení, zelená šipka) nezbarvují alginát, zatímco agregát pozitivní na Borrelia měl na povrchu významné množství alginátu (modré zabarvení, modrá šipka). Abychom dále dokázali, že antigeny B. burgdorferi a alginát markeru biofilmu byly kolokalizovány, provedli jsme konfokální mikroskopické analýzy na IHC-pozitivních tkáňových řezech. Obrázek 7 poskytuje reprezentativní konfokální mikroskopický snímek B. burgdorferi– a alginát-pozitivní agregát v tkáni jaterní pitvy. Prostorová distribuce získaného fluorescenčního barvení potvrdila kolokalizaci antigenů B. burgdorferi a alginátu a ukázala, že alginát je na povrchu dobře vytvořeného agregátu pozitivního na B. burgdorferi .

Obrázek 6. Reprezentativní trojrozměrný (3D) konfokální snímek  pitvy tkáně srdce pozitivní na  Borrelia spirochety a Borrelia biofilm. Sekce pitevní tkáně byla imunobarvena protilátkami proti Borrelia (zelená) a alginát (modrá) a analyzována konfokální mikroskopií s využitím jednotlivých z-svazků, aby se získal kompozitní 3D pohled (obrázek J) prostorového rozložení Borrelia spirochet (zelené šipky) a Borrelia agregátů s alginátem na povrchu (modrá šipka) v infikované tkáni srdce. Měřítko: 20 μm.

Obrázek 7. Trojrozměrná (3D) analýza biofilmu Borrelia v infikované tkáni jater. ( A , B ) Fluorescenční mikroskopické snímky tkáně jaterní tkáně pozitivně imunobarvené protilátkami proti borreliovým (zeleným) a alginátovým (modrým) antigenům. Měřítko: 100 um. Konfokální mikroskopické analýzy stejného řezu tkání byly provedeny za použití jednotlivých z-svazků za vzniku složeného 3D obrazu (obrázek J) pro ilustraci prostorové distribuce biofilmu Borrelia ( C ) a biofilmu Borrelia s povrchovým alginátem ( D ). Měřítko: 100 um.

figure 7

Poté jsme hledali přítomnost DNA B. burgdorferi asociované s biofilmy ve všech čtyřech orgánech pomocí dříve validovaného a publikovaného postupu FISH kombinovaného s alginátem IHC [ 43 ]. Výsledky FISH ukázaly, že agregáty jsou pozitivní na B. burgdorferi- specifickou 16S rDNA ve všech čtyřech tkáních ( obrázek 8 , panely A, G, M a S; zelená šipka). V B. burgdorferi DNA pozitivní agregáty, ale ne spirochety ( Obrázek 8 , panely B, malý zelený hrot šípu), také imunologicky alginátu protilátkou ( Obrázek 8 , panely B, H, N, a T, modrá šipka). Pro vizualizaci morfologie struktury biofilmu a okolní tkáně byla použita DIC mikroskopie Obrázek 8 , Panely C, I, O a U). Pro negativní kontroly všech experimentů FISH, konkurenční oligonukleotidové sondy ( obrázek 8 , panely D, J, P a V), vzorky ošetřené DNázou I ( obrázek 8 , panely E, K, Q a Y) a náhodná DNA sonda ( Obrázek 8 , Panely F, L, R a Z) byly použity k testování specificity 16S rDNA sond na sekvenčních tkáňových sklíčcích. Žádný z experimentálních podmínek negativní kontroly nevedl k žádnému pozitivnímu zbarvení na žádné ze studovaných tkání.

Obrázek 8. Reprezentativní snímky přítomnosti biofilmu DNA Borrelia pomocí fluorescenční in situ hybridizace (FISH) kombinované s alginátem IHC v mozkových, srdečních, ledvinových a jaterních pitevních tkáních. Výsledky FISH ukázaly pozitivní barvení na Borrelia DNA ve všech čtyřech orgánech ( A , G , M , S ; zelená šipka) pomocí Borrelia- specifických 16S rDNA sond. Tyto Borrelia positivní agregáty, ale ne spirochety ( G : malá zelená šipka), jsou také barveny alginátovou protilátkou ( B , H , N , T; modré zbarvení). K vizualizaci morfologie struktury biofilmu a okolní tkáně byla použita mikroskopie s diferenčním interferenčním kontrastem (DIC) ( C , I , O , U ). Pro negativní kontroly všech experimentů FISH, konkurenční oligonukleotidové sondy ( D , J , P , V ), vzorky ošetřené DNázou I ( E , K , Q , Y ) a náhodná oligonukleotidová sonda ( F , L , R , Z ) byly použity k testování specificity sond 16S rDNA. Měřítko: 200 μm.

figure 8

Provedli jsme také kvantitativní analýzu experimentálních údajů FISH-IHC na celkem 210 mozkových, 130 srdečních, 145 ledvinových a 150 jaterních řezech po sobě jdoucích pro velikost a frekvenci biofilmů B. burgdorferi . Získané výsledky ukázaly některé, ale nikoli statisticky odlišné variace, jak jsme zjistili v IHC analýzách: mozkové tkáně obsahovaly 0–3 biofilmů na sklíčko, s velikostí biofilmu 20–150 μm, zatímco tkáně srdce a ledvin obsahující 0–4 biofilmů na sklíčko mělo velikost biofilmu v rozmezí 20–100 μm. Tkáně jater obsahovaly 0–6 biofilmů na sklíčko s velikostí biofilmu v rozmezí 20–300 μm ( tabulka 2 ).

 

Tabulka 2. Kvantitativní analýza experimentů FISH na biofilmech Borrelia v mozku, srdci, ledvinách a játrech.

 

Orgán Počet IHC obarvených sklíček Počet biofilmů na snímek ± SD Velikost biofilmu (µm)
Mozek 210 0–3 ± 1,1 20–150
Srdce 130 0–4 ± 1,2 20–100
Ledviny 145 0–4 ± 1,1 20–100
Játra 150 0–6 ± 1,5 20–300

 

2.5. Údaje o PCR / celo genomovém sekvenování / metagenomice

Další sada experimentů byla navržena tak, aby poskytla další důkaz pro Borrelia DNA v pitevních tkáních. Genomická DNA purifikovaná ze všech čtyř orgánů byla použita pro standardní B. burgdorferi- specifické 16S rDNA PCR analýzy, jak bylo popsáno dříve [ 43 ], a amplifikované DNA byly odeslány pro přímé sekvenování.

Výsledky PCR pro všechny čtyři orgány (mozek, srdce, ledviny a játra) vedly k DNA pozitivní na B. burgdorferi . Analýzy nástroje Basic Local Alignment Search Tool (BLAST, NBCI) potvrdily 99–100% identitu s kmeny B. burgdorferi sensu strictro (data neuvedena). Kvůli známému problému s falešnou pozitivitou PCR v klinických vzorcích [ 51 ], také jsme poslali vzorky DNA pro nezávislé ověření. Sekvenování celého genomu (WGS), kombinované s metagenomickými analýzami, bylo provedeno tak, jak je popsáno v části Materiály a metody v PerkinElmer DNA Sekvenční a analytické služby (Branford, CT, USA) na genomové DNA extrahované ze všech čtyř tkání. Kvůli vysoké degradaci 16 + -letých vzorků, pouze tkáně jater produkovaly kvalitu DNA vhodné pro WGS. Jako negativní kontrola byly vzorky DNA získány také z normálních lidských jaterních tkání (Columbia University Pathology, New York, NY, USA) a poslány paralelně pro stejné analýzy WGS-metagenomiky. Metoda Illumina WGS produkovala přes 186 milionů DNA sekvenčních čtení (100 bázových / každý), které obsahovaly jak lidské, tak nehumánní sekvence. Odečty byly zarovnány s lidskou referencí GRCh37 s Burrowsem ‒ Wheeler Aligner (BWA), V 0,6,2. (Bio-bwa.sourceforge.net,http://bio-bwa.sourceforge.net ). Výsledné soubory zarovnání (bam) byly filtrovány pomocí Samtools (Htslib.org, http://www.htslib.org ), aby se odstranily čtení, které byly mapovány na lidskou referenci. Zbývající hodnoty byly poté filtrovány, aby se odstranily nekvalitní hodnoty pomocí Trimmomatic (Usadellab.org, http://www.usadellab.org/cms/?page=trimmomatic ). Zbývající vysoce kvalitní odečty byly poté mapovány pomocí BWA proti referenčním genomovým sekvencím B. burgdorferi , což vedlo k 517 různým přečtením. Poté byly dále analyzovány jejich sladěním s referenčními sekvencemi pro Borrelia burgdorferikmeny sensu lato a sensu stricto pomocí základního vyhledávacího nástroje místního zarovnání (BLAST) z webových stránek Národního centra pro biotechnologické informace (Ncbi.nlm.nih.gov, https://www.ncbi.nlm.nih.gov ). Tato zarovnání vedla ke 14 sekvencím, které mapovaly různé kmeny B. burgdorferi sensu stricto s> 99% identitou a> 99% pokrytím. Následující kmeny Borrelia odpovídaly sekvencím se stejnou identitou a pokrytím.

Kmeny B. burgdorferi 382, N40, B331, JD1, HB19, Pali a PAbe prokázaly přítomnost B. burgdorferi sensu stricto a dále potvrdily naše předchozí PCR data ( tabulka 3 ).

 

 

Tabulka 3. Skutečné sekvence, genové / genomické oblasti a procento pokrytí / identity s hodnotami E. Dalších 20 sekvenčních čtení bylo z 517 čtení, což byly shody pro jiné kmeny Borrelia s> 90% identitou a pokrytím, ale také měly podobné identity jako jiné bakteriální druhy (data neuvedena). Pro kontrolní játra prošlo metagenomickou analýzou pro B. burgdorferi osm sekvencí , ale neodpovídaly žádnému druhu Borrelia .

 

Čtení
sekvencí celého genomu pro kmeny Borrelia Burgdorferi Sensu Stricto
Gen / region Dosah Identita Hodnota E
AGCTTTGCTATCTCAAATGTCAAAGACTCTATCTCTTCTTGAGAAAGATACTTAAACACTTTAGAAGAGATTTCAGAACCTATTGAAACCAACAAATAG Proteinový protein flagella (fliG) 100% 100% 3e − 42
AAAACTATTAAAATTACCCTTAACAATTGCAATGTAAACTTTATTTGTTCTTTTATCTTTAAACTGCTGAGCTAAAAATCTTAAGGTGCTAATGTTTTTT Protein helikázy (Yfi) 100% 99% 1e − 40
AAGGTCTTATGCCAATAAAAATCCAATCACAGAATACAAAGAAGAGGGGTTTCAATATTTAGCGAGCTTATTAAAGATATTAAAGTTTCTACCATAAGG SecA protein 100% 100% 3e − 42
AAGAAAAGATTTTCCTATTTTAAATAAAAAATTTGACAATAAGTATATAATTTACTTTGATAATGCAGCAACCTCTCAAAAGCCCAAAAACGTAATTTAT Aminotransferáza M11p (nifS) 100% 100% 3e − 35
ATTACAGCGTTACTGTTTTAATGAAGCAATTGCCATACTATCAAAACCAATTAGCATTTATCATGAAAGATGTGCTTAGTCGATATAAAGTTGATAGTTC Levá subtelomerická chromozomální oblast 100% 100% 3e − 42
TCATTTCAAAAACATGTATTTCTGAAAGCAAAAAATACAACAGCAAAAAACTACTACCAAACTGCTTGTAAATCCAATAATTTCATTATAAGCTCTTGT Levá subtelomerická chromozomální oblast 100% 100% 3e − 42
TTGAATATTTTGAAATAACTTATGAGGCTTATGCTCCTTATGGAGTGGCTCTAATGATTAAATGCTTAACGGATAATAAAAACAGAACCTCTAGCGATGT Intergenní region 100% 100% 3e − 42
AAGAAGAATTAGAAGTTTGCGAGCTAAATGGAAAAGATTGGACATTAAAATTTAAAAAACCGCTAAAAGCATATAAATTCTTAAAATCCGTAGGAAG Intergenní region 99% 100% 1e − 40
TTACTAAAACTTCAGAAGAGCCCCTAATGCTTGTTTTAATGATAGGCATTATTTCTTTGGCCTGTTGATAGTCTATGTTTGTGTATGTATTGTTATTCAT Intergenní region 100% 99% 1e − 40
AATCTTAAAATTAAAAGATAACGACAAATTTAAATTTGGTATTCTTGGAGAAAAAAAACATTTACCACTGCATTTACAAAAAGATAAAAAATATTTTTC Intergenní region 100% 100% 3e − 42
TAAGTTATAATTGAGGAATAATAGCAAATATTTTAACTTTTTTGGTATAAATTACTACTAGATTTATATGTTAAGTTTTGCGAGGTATTTAAATGGCAGTA Intergenní region 100% 99% 1e − 40
CAAGAGTTAGTATTGGCCTTAAAAAACGATAAAGTTGATTATATATATGGTGATTGCAAGACTTTACATTATATTGCAAATAACTTTTTAAGTGA Intergenní region 100% 100% 1e − 39
CTTGAGGGATTTAAAGAAGTTAAGCCTGTAGTATTCTCTTCAGTTTATCCGTTGATGCTAATCAATATGATGATCTTTTAAGGGCAATGGATAGATTAA Intergenní region 100% 99% 1e − 40
TTTATACTAATAAACTTTCAATTTCTTTTGTGAAGATATTGAAAGAAATCCATGTCTGTTGAGAAAATTTTTCTTTTATCTTTTAATACTGCTTTATAGC Intergenní region 100% 100% 3e − 42

 

2.6. Infiltrace CD3 + T lymfocytů

Jak je popsáno výše, pozitivní imunobarvení CD3+ lymfocytů bylo nalezeno ve všech čtyřech orgánech v počátečních histopatologických analýzách. Abychom sledovali toto pozorování, ptali jsme se, zda přítomnost biofilmu B. burgdorferi prostorově koreluje s distribucí CD3 + lymfocytů, což ukazuje na potenciální lokální zánět tkáně vedle biofilmů B. burgdorferi . Proto jsme v další sadě experimentů analyzovali tkáňové řezy pozitivní na B. burgdorferi / alginát pro infiltraci CD3 + T lymfocytů ze čtyř orgánů. Nejprve jsme identifikovali řezy s pozitivním imunostainováním na Borrelia ( obrázek 9 , panely A, E, I a M; zelené barvení) a alginát ( obrázek 9), Panely B, F, J a N; červené barvení) za použití postupů IHC, jak je popsáno výše, k zobrazení struktur biofilmu. V dobré shodě s předchozími experimenty IHC byla jako negativní kontrola použita nespecifická IgG izotypová kontrola ( obrázek 9 , panely C, G, K a O). Po nalezení biofilmu byly sousední sklíčka obarveny protilátkou CD3. Zatímco srdeční tkáně neodhalily žádné CD3 + buňky ( obrázek 9 , panel H), mozkové, ledvinové a jaterní tkáně prokázaly agregáty CD3 + lymfocytů obklopujících biofilmy B. burgdorferi ( obrázek 9), Panely D, L a P), ale ne sousední tkáně. Je zajímavé, že velikost biofilmu nekorelovala se závažností lymfocytárního zánětu, protože velmi malý biofilmový agregát v ledvinové tkáni byl spojen s výraznou lymfocytární odpovědí ( obrázek 9 , panel L), zatímco výsledkem větší struktury biofilmu v játrech ve více lokalizovaném vzoru obarvení CD3 ( obrázek 9 , panel P).

Obrázek 9. Reprezentativní IHC obrázky Borrelia , alginátu a CD3 + T lymfocytů barvení v infikovaných řezech tkáně mozku, srdce, ledvin a jater. Řezy tkání, které měly pozitivní barvení na Borrelia (zelené barvení: A , E , I , M ) a alginát (červené barvení: B , F , J , N ), byly podrobeny dalším IHC analýzám imunobarvením sekvenčních řezů T buněčným markerem, Protilátka specifická pro CD3+ (hnědé zabarvení: D , H , L , P). Fluorescenční snímky byly pořízeny při 100násobném zvětšení pro ilustraci větší části tkáně. CD3-pozitivní lymfocyty obklopovaly tyto agregáty, jak je znázorněno hnědým zbarvením v mozku, ledvinách a játrech ( D , L , P ). Nebyly přítomny CD3-pozitivní lymfocyty v srdečních tkáních ( H ). Nespecifická IgG protilátka byla použita jako negativní kontrola pro primární protilátky ( C , G , K , O ). Měřítko: 100 μm.

figure 9

3. Diskuze

3.1. Dlouhodobá perzistence Borrelia Antigens a DNA

V této studii jsme se ptali, zda existují důkazy o B. burgdorferi u pacientky s lymskou nemocí, která byla během 16leté nemoci podrobena rozsáhlé léčbě antibiotiky. Přes tento dlouhý léčebný protokol měla pacientka opakující se příznaky lymské nemoci, včetně neurologického zhoršení, bolesti kloubů a závažného zhoršení plicní funkce, a nakonec zemřela [ 11 , 47 , 48 , 49 ]. Vyšetření jaterních, srdečních, ledvin a mozkových tkání odhalilo významné patologické změny a rovněž poskytlo několik linií důkazů o přítomnosti antigenu / DNA Borrelia ve všech studovaných tkáních. Prokázat přítomnost B. burgdorferiDNA, kromě FISH a standardní PCR, jsme použili nezávislý ověřovací přístup pomocí WGS / metagenomiky, který odhalil významné množství B. burgdorferi- specifických DNA sekvencí v jaterních tkáních. Dále IHC, FISH a konfokální mikroskopie odhalila nejen spirochety, ale také agregáty Borrelie v játrech, srdci, ledvinách a mozku.

 

3.2. Antigeny Borrelia a DNA jsou spojeny s biofilmy

Přítomnost velkého počtu pozitivních struktur B. burgdorferi , jakož i dlouhodobé přetrvávání symptomů Lymeské nemoci, svědčí pro chronické onemocnění odolné vůči antibiotikům. Jednou hypotézou o perzistenci je, že různé morfologické formy Borrelia mohou chránit bakterie před antibakteriální terapií, protože B. burgdorferi může existovat ve spirochetálních, kulatých tělech a biofilmech [ 29 , 30 , 41 , 42 , 43 ]. Naše výsledky podporují tuto hypotézu a ukazují, že Borrelia je v každém orgánu přítomna hlavně ve formě biofilmu. B. burgdorferi agregáty obsahovaly dobře zavedený alginát, marker biofilmu, což naznačuje, že se jedná o skutečné biofilmy. Biofilmy jsou agregáty volných  mikroorganismů, které se váží na biotické a abiotické povrchy a poskytují ochranu jednotlivým buňkám před nepříznivými podmínkami prostředí, jako je pH, teplota, volné radikály, antibiotika a antimikrobiální látky, jakož i vysoké koncentrace kyslíku [ 33 , 34 ] . Tyto rezistentní agregace rostou kontinuálním rozšiřováním oddělením a rozesetím na okolní povrchy, což způsobuje chronické infekce [ 35 , 36 , 37 ]. V lidském těle jsou biofilmové formace patogenními druhy jedním z hlavních důvodů rozvoje chronických chorob [ 37]. Biofilmy jsou všudypřítomné v normálních a patogenních lidských procesech a poskytují homeostázu v různých nepřátelských prostředích [ 33 ]. Jsou drženy pohromadě a chráněny bariérou známou jako extracelulární polymerní substance (EPS), skládající se z proteinů, nukleových kyselin, extracelulární DNA, polysacharidů včetně alginátu, různých lektinů a glukosaminů [ 34 , 41 , 42 ]. Úlohou vrstvy EPS je chránit bakterie před nepřátelským prostředím a také zvyšovat její přilnavost k pevným povrchům [ 34 ].

S biofilmy bylo spojeno několik chronických infekcí, jako je Pseudomonas aeruginosa , spojené s cystickou fibrózou, keratitidou z kontaktních čoček, infekcí močových cest z Escherichia coli , osteomyelitidou nebo endokarditidou způsobenou Staphylococcus aureus a plicními infekcemi způsobenými Streptococcus pneumoniae . [ 52 , 53 , 54 , 55 , 56 ]. Přítomnost biofilmů v těchto podmínkách může ovlivnit funkci hostitelských buněk a může vést k zánětu a poškození tkáně [ 56 , 57 ].

Existence biofilmu B. burgdorferi byla prokázána in vitro i in vivo u boreliálních lymfocytárních kožních lézí [ 41 , 42 , 43 ]. Biofilmové markery, jako jsou alginát a lektiny, klíčové složky EPS vrstvy u jiných bakterií tvořících biofilm, byly také nalezeny v biofilmech Borrelia [ 41 , 42 , 43 ].

Podobně jako biofilm P. aeruginosa se biofilm B. burgdorferi také tvoří k ochraně jednotlivých spirochet před imunitním systémem a před antimikrobiálními látkami. Je známo, že biofilmové infekce jsou rezistentní na antibiotika [ 58 ]. Již dříve jsme prokázali, že určitá antibiotika, jako je doxycyklin, která jsou velmi účinná proti spirochetálním formám B.B., nemohou eliminovat biofilm B. burgdorferi , který se může po expozici antibiotiky dokonce zvětšit [ 44 , 45 , 46 ]. Naše nedávné studie prokázaly, že pouze určité antimikrobiální látky a kombinace antibiotik jsou schopny zmenšit velikost borreliových biofilmů [ 45 , 46 ].

Další hypotézou je prodloužená imunitní odpověď vytvořená pokračující přítomností antigenních zbytků nebo imunogenních peptidoglykanů zbavených B. burgdorferi [ 59 , 60 ]. Skutečnost, že tato pacientka byla intenzivně léčena během nemoci 16 let, však proti této myšlence odporuje,  je nepravděpodobné, že by úlomky mohly v tomto časovém období přetrvávat. V modelu potkaní artritidy, zatímco fragmenty streptokokové bakteriální buněčné stěny byly detekovány několik měsíců po jejich systémovém podání, byla hladina tohoto antigenu v 90-denním časovém bodě téměř nedetekovatelná [ 61 ].

 

3.3. Borreliová DNA dlouhodobě persistuje

Nukleové kyseliny jsou vynikajícími analytickými nástroji pro přímé diagnostické testy, protože DNA / RNA lze rychle odstranit z lidského těla [ 62 , 63 ]. Ve studii myší, ve které bylo B. burgdorferi, které bylo tepelně usmrceno, injikováno pod kůži myší, se borreliální DNA stala prakticky nezjistitelnou po 8 hodinách [ 64 ]; stejná studie ukázala, že v kůži, uchu, kotníku nebo srdečních tkáních myší, které dostaly usmrcené bakterie dva a čtyři týdny po injekci , nebyly detekovány žádné genomické materiály B. burgdorferi . Kromě toho v modelu myší ošetřených ceftriaxonem, který sledoval perzistenci nekultivovatelných B. burgdorferi monitorováním hladiny patogenní DNA po dobu 12 měsíců, Borreliové hladiny DNA byly původně po léčbě ceftriaxonem odstraněny, ale po 12 měsících se znovu objevily, což svědčí o přetrvávající infekci [ 17 , 23 ]. V jiné studii primátů (kromě člověka) byly životaschopné B. burgdorferi získány xenodiagnózou a in vivo kulturami z makaků rhesus ošetřených antibiotiky i neošetřených makaků infikovaných B. burgdorferi [ 20 , 21 ]. Kromě toho byly intaktní spirochety pozorovány v mozku a srdci makaků rhesus infikovaných B. burgdorferi 8–9 měsíců po léčbě antibiotiky [ 22 ]. Několik studií u lidí rovněž naznačovalo, že chronická forma lymské choroby může být způsobena přetrvávající spirochetální infekcí [ 2526 , 27 , 28 ]. Naše data jsou v souladu s těmito zjištěními a poskytují důkaz, že přítomnost DNA B. burgdorferi po léčbě antibiotiky se vztahuje i na člověka.

 

3.4. Dlouhodobá infekce je spojena s multiorgánovou patologií

Našli jsme patologii v CNS, PNS, játrech, ledvinách a srdci. Zdá se, že velká část patologie má hypoxickou / ischemickou povahu. V srdečním svalu a ledvinách tedy došlo k rozsáhlému zjizvení vláken. CNS obsahoval infarkty akutní, subakutní a chronické patologie. Zjistili jsme uzavřené krevní cévy, ačkoli nedošlo k akutní vaskulitidě a rozšířený perivaskulární zánět. V jednom nervovém kořeni bylo malé ložisko zánětu. Patologické změny nervového systému u meningokluzivního vaskulárního onemocnění, parenchymálních infarkttů a perivaskulárního mononukleárního zánětu je v souladu s předchozími zprávami. Mononukleární, perivaskulární infiltráty byly přítomny v meningech a mozkovém a šňůrovém parenchymu u pacienta se subakutním průběhem [ 65 ] a chronická meningitida s okluzivním meningovaskulárním onemocněním a parenchymálními infarkty u pacienta s tříletým průběhem [ 66 ]. Ve druhé zprávě autoři našli obrázky shodné se spirochetami se skvrnou Warthin ‒ Starry. Při jedné pitvě a dvou biopsiích pacientů s CNS Lyme, Oksi et al. hlásili perivaskulární zánět a při pitvě subkortikální demyelinizaci [ 67 ]. Buď CSF nebo mozková tkáň, nebo obojí, byly pozitivní na DNA B. burgdorferi pomocí PCR. Jiné zprávy popisují klinické a radiografické důkazy vaskulitidy a cévní mozkové příhody [ 68 , 69 ], jak je uvedeno v Miklossy [ 70 ]. Rozsáhlé studie, které jsme provedli, ukazují nejen spirochetální organismy používající anti-Borrelia protilátka, ale také B. burgdorferi DNA a související biofilm.

 

3.5. Zánět T-buněk je spojen s Biofilmem

Imunitní odpověď proti planktonickým bakteriím je velmi dobře studována u mnoha různých bakterií, včetně B. burgdorferi [ 71 ], ale o imunitní odpovědi na patogenní biofilm je známo mnohem méně [ 72 ]. Naše pozitivní údaje IHC o přítomnosti infiltrujících T buněk vedle agregátů Borrelia naznačují spojení mezi biofilmem B. burgdorferi a zánětlivou odpovědí hostitele a vyvolávají otázku, co přitahovalo lymfocyty na místo biofilmu. Je zajímavé, že to nemusí být nutně antigeny B. burgdorferi , protože nedávné studie ukázaly, že složky EPS biofilmu, jako je alginát, mohou mít silnou antigenicitu [ 73 ]. Ve studii plicní nemoci měli pacienti s infekcí P. aeruginosa vysoké hladiny titrů protilátek proti alginátu ve svých sérech, s pozitivním spojením se závažností nemoci [ 73 ]. V jiné studii vedly infikované subkutánní rány králíků P. aeruginosa ke zpoždění hojení ran a masivní zánětlivé odpovědi [ 74 ]. Jejich zjištění rozsáhlých množství extracelulární polymerní látky (EPS) v infikovaných ranách vedla ke zkoumání úlohy EPS v patogenním procesu. V následné studii ukázali, že rány infikované P. defuginózou s nedostatkem EPSmutanti měli kratší dobu hojení s menším zánětem, zatímco struktury biofilmu byly stále nalezeny v ranách, což naznačuje význam EPS v zánětlivých procesech [ 75 ]. Ve studii provedené s cílem zjistit, jak prsní implantáty s bakteriálními biofilmy vedou ke zvýšení infiltračních T lymfocytů, byly implantáty vloženy do prasat a naočkovány lidským patogenem, Staphylococcus epidermis , bakterií vytvářející biofilm [ 76 ]. IHC barvení infikovaných implantátů ukázalo vysoký počet struktur biofilmu s okolními CD3 + lymfocyty [ 76 ]. V naší studii B. burgdorferibiofilmy sousedily s CD3 + T lymfocyty v mozku, ledvinách a játrech. V současné době zkoumáme další zánětlivé markery v těchto tkáních, abychom lépe porozuměli spojení biofilmu Borrelia s reakcí hostitele. Rovněž reanalyzujeme naše (WGS) / metagenomické sekvenční čtení pro další potenciální patogeny v jejích tkáních, abychom vyhodnotili, zda (její) jiný infekční agens mohl přispět k jejímu onemocnění.

Jedním ze zřejmých omezení této studie je, že zkoumala potenciální přítomnost B. burgdorferi v několika hlavních orgánech jednoho pacienta s Lymeskou chorobou, nikoli u více pacientů. Tento pacient je však jedinečný, protože byla prvním hlášeným pacientem, který měl pozitivní kultivaci ve Spojených státech [ 11 ]. Skutečnost, že v tomto případě máme k dispozici pitevní tkáně z hlavních orgánů, je mimořádně vzácná a nejsme si vědomi existence více tkáňových pitev z jakéhokoli dosud dobře zdokumentovaného případu lymské choroby. Naše výzkumná skupina se dále skládala z praktického lékaře (KBL) a dvou případových patologů (JEG a JL), kteří měli podrobnou znalost tohoto případu. Naše studie však jasně ukazuje naléhavou potřebu zavedených biobank pro lidské biopsie a pitevní tkáně od pacientů s lymskou chorobou. Bez těchto výzkumných materiálů nebudeme schopni provést základní studie s cílem lépe porozumět infekci B. burgdorferi a progresi lymské choroby v lidském těle.

V souhrnu poskytujeme důkazy o B. burgdorferi- specifických antigenech a DNA v játrech, srdci, ledvinách a mozku od dobře zdokumentované pacientky s Lymeskou chorobou, která byla během 16leté nemoci podrobena rozsáhlé antibiotické léčbě. Výsledky této studie naznačují, že B. burgdorferi může v lidském těle přetrvávat v biofilmové formě i po dlouhodobé léčbě antibiotiky.

4. Materiály a metody

4.1. Získání a zpracování pitevní tkáně

Pitva byla provedena pět dní po smrti v Columbia University Medical Center. Po fixaci formalínem byly orgány nařezány a tkáně byly vloženy do parafinu. Mozek byl rozdělen koronálně a mozkový kmen a šňůra napříč. Několik částí bylo odebráno z kůry a bílé hmoty hemisfér, bazálních ganglií, thalamu, mozkového kmene a míchy, zapuštěných do parafínu. Všechny tkáňové řezy byly obarveny hematoxylinem a eosinem, CNS navíc Luxol fast blue pro myelin a Bielschowsky stříbrné barvení pro axony v Columbia University Medical Center. Všechny tkáně byly také imunofarbeny protilátkami proti CD3 a CD20 za použití Pathologických služeb Columbia University Medical Center Pathology.

Parafinem zabudované řezy mozku, srdce, ledvin a jater a neinfikované řezy lidské pitevní tkáně (4 μm) byly po obdržení souhlasu Institucionální revizní rady University of New Haven předány výzkumné laboratoři Lyme Disease Research Laboratory University of New Haven . Normální tkáně byly získány z řezů tkáně parafinů lidského mozku, srdce, ledvin a jater od pacienta stejného věku a pohlaví bez neurologických příznaků nebo symptomů a bez neuropatologických změn.

 

4.2. Imunohistochemie (IHC)

Parafinové řezy čtyř orgánů (mozek, srdce, ledviny a játra) byly podrobeny dvěma různým postupům IHC, oba validovány a popsány dříve [ 43 , 47 ]. Jeden z postupů IHC byl navržen tak, aby přidal protilátky B. burgdorferi a alginát ke stejnému tkáňovému sklíčku, a v dalším postupu IHC byla alginátová protilátka přidána do sekvenčního tkáňového řezu, jak bylo popsáno dříve [ 43 ]. Jediný rozdíl od publikovaného protokolu byl v tom, že jsme použili dvě odlišně označené sekundární protilátky pro alginátovou primární protilátku. Pro experimenty IHC byl buď označen fluorescenční červenou značkou (kozí anti-králičí IgG (H + L), konjugovaný DyLight 594), nebo fluorescenční modrou značkou (kozí anti-králičí IgG (H + L), konjugovaný DyLight 405)) pro analýzy FISH a konfokální mikroskopie.

Jako negativní kontroly byly tkáňové tkáně lidského mozku, srdce, ledvin a jater parafinové tkáně od pacienta stejného věku a pohlaví bez neurologických příznaků nebo symptomů a žádné neuropatologické změny barveny stejným postupem jako výše. Další negativní kontroly zahrnovaly komerčně dostupné řezy lidského mozku, ledvin, srdce a jater (20 každého, US Biomax, Rockville, MD, USA). Jako IHC negativní kontroly byly místo primárních protilátek použity nespecifické kontroly izotypu IgG (IgG1 Isotype Control, Invitrogen, Carlsbad, CA, USA MA1-10406).

Pro nezávislé potvrzení byly řezy mozkové tkáně zaslány na Innsbruck Medical University a imunofarbeny protilátkou specifickou pro B. burgdorferi pro potvrzení přítomnosti Borrelia spp. s využitím Ventana-KIT (Ventana Medical Systems, Mnichov, Německo), jak bylo popsáno dříve [ 50 ].

Další barvení IHC pro markery CD3 + T buněk používalo parafinové řezy, které byly sekvenční k řezům s pozitivním B. burgdorferi. Postup IHC pro CD3 zahrnoval krok získání antigenu po deparafinizaci tkání. Sklíčka byla ponořena do koplinové nádoby s předehřátým zprostředkovaným pufrem pro získávání antigenu (10 mM citrát sodný, 0,05% Tween 20, pH 6,0) při 99 ° C po dobu 10 minut, po čemž následovala 20 minutová inkubace při teplotě místnosti. Sklíčka byla poté umístěna pod pomalu tekoucí vodu z kohoutku, aby se odstranily stopy pufru citronanu sodného po dobu 10 minut při teplotě místnosti. Pro enzymatické sekundární barvení byla použita sada Vectastain ABC HRP (Peroxidase, Rabbit IgG) od Vector Laboratories (kat. Č.: PK-4001, Vector Laboratories, Burlingame, CA, USA) podle protokolu výrobce. Stručně, sklíčka byla promyta 4krát v 1 x PBS pH 7,4 po dobu 5 minut / každý a inkubována se zředěným normálním blokačním kozím sérem po dobu 20 minut ve zvlhčené komoře při teplotě místnosti. Po inkubační periodě byla sklíčka znovu promyta 3 x 1 x PBS pH 7,4 po 5 min / každý a do řezů byla přidána CD3-specifická primární protilátka [Abcam, kat. Č .: ab5690], následovaná inkubace ve zvlhčené komoře při 4 ° C přes noc. Následující den byla sklíčka promyta 4 x 1 x PBS pH 7,4 po dobu 5 minut / každý a inkubována po dobu 30 minut se zředěným roztokem biotinylované sekundární protilátky ve zvlhčené komoře při pokojové teplotě. Sklíčka byla znovu promyta 4x 1X PBS pH 7,4 po dobu 5 minut / každý a inkubována s Vectastain ABC činidlem po dobu 30 minut ve zvlhčené komoře při teplotě místnosti. K vizualizaci pozitivní reakce s kolorimetrickým zbarvením (hnědé skvrny) byla použita souprava substrátu peroxidázy DAB (Vector Laboratories). Řezy byly kontrastně barveny hematoxylínem (BBC Chemical, Mount Vernon, WA, USA) a namontované s médiem Permount (Fisher Scientific, Hampton, NH, USA). Snímky byly pořízeny mikroskopem Leica DM2500 (Leica, Wetzlar, Německo) při zvětšení 100 ×, 200 × a 400 ×.

 

4.3. Kombinovaná IHC a fluorescenční hybridizace in situ (FISH)

Parafinové řezy čtyř orgánů (mozek, srdce, ledviny a játra) byly podrobeny kombinované metodě IHC a FISH, která byla validována a popsána dříve [ 43 ]. Kontrolní experimenty pro FISH zahrnovaly náhodné sondy (5′-FAM-GCATAGCTCTATGACTCTATACTGGTACGTAG-3 ‘), konkurenční oligonukleotidy pro Borrelia (5′-CAAACGGGGAATAATTATCTCTAACTATATCC-3′) a vzorky ošetřené DNázou I podle dříve publikovaného protokolu (43).

 

4.4. Extrakce DNA / PCR

Genomické DNA byly extrahovány z tkání zabudovaných do parafinu s použitím soupravy tkáňových souprav Qiagen QIAamp DNA formálně fixovaných, zafixovaných do parafinu (FFPE) (Qiagen, Hilden, Německo). Nejprve byla sklíčka deparafinizována, jak je popsáno výše, a tkáně přítomné na sklíčkách byly seškrábnuty pomocí sterilních lopatek a shromážděny do sterilních mikrocentrifugačních zkumavek. Poté bylo do zkumavek přidáno 180 ul ATL pufru a 20 ul proteinázy K a vzorky byly inkubovány přes noc při 42 ° C a poté při 90 ° C po dobu 1 h pro deaktivaci enzymu. Ke vzorkům bylo přidáno dalších 200 ul AL pufru a dalších 200 ul 96% ethanolu a důkladně promíchány. Vzorky byly poté přeneseny do mini-kolon DNeasy a centrifugovány po dobu jedné minuty při 6000xg. Průtok byl odstraněn a kolony byly umístěny do nových sběrných zkumavek. K vymytí veškerých nežádoucích materiálů, které by mohly být přítomny spolu s DNA, bylo přidáno 500 ul AW1 a AW2 pufrů postupně do kolon a odstředěno při 6000 x g po dobu 1 minuty. Rotační kolony byly poté umístěny do čerstvých sběrných zkumavek a centrifugovány při 20 000 xg po dobu 3 minut, aby byly kolony zcela vysušeny. Kolony byly poté umístěny do nových mikrocentrifugačních zkumavek a vzorky byly eluovány dvakrát 50 ul ATE pufru / každý krok. Vzorky DNA byly kvantifikovány pomocí mikrotitračního spektrofotometru BioTek (Winooski, VT, USA). Vzorky DNA byly nejprve testovány pomocí standardní PCR za použití primerů navržených pro amplifikaci Rotační kolony byly poté umístěny do čerstvých sběrných zkumavek a centrifugovány při 20 000 xg po dobu 3 minut, aby byly kolony zcela vysušeny. Kolony byly poté umístěny do nových mikrocentrifugačních zkumavek a vzorky byly eluovány dvakrát 50 ul ATE pufru / každý krok. Vzorky DNA byly kvantifikovány pomocí mikrotitračního spektrofotometru BioTek (Winooski, VT, USA). Vzorky DNA byly nejprve testovány pomocí standardní PCR za použití primerů navržených pro amplifikaci Rotační kolony byly poté umístěny do čerstvých sběrných zkumavek a centrifugovány při 20 000 xg po dobu 3 minut, aby byly kolony zcela vysušeny. Kolony byly poté umístěny do nových mikrocentrifugačních zkumavek a vzorky byly eluovány dvakrát 50 ul ATE pufru / každý krok. Vzorky DNA byly kvantifikovány pomocí mikrotitračního spektrofotometru BioTek (Winooski, VT, USA). Vzorky DNA byly nejprve testovány pomocí standardní PCR za použití primerů navržených pro amplifikaciRibozomální DNA B. burgdorferi 16S s použitím publikovaných primerů: F: 5′- CCTGGCTTAGAACTAACG-3 ‘; R: 5’-CCTACAAAGCTTATTCCTCAT-3 ‘. PCR reakce (50 ul) obsahovala HotStarTaq pufru (Qiagen), 1,5 mM MgCl 225 pmol každého primeru a 2,5 jednotky HotStarTaq DNA polymerázy (Qiagen) v objemu 50 μl. Podmínky PCR byly: počáteční denaturace při 94 ° C po dobu 15 minut, následované 40 cykly 94 ° C / 30 s, 50 ° C / 30 s, 72 ° C / 1 min, pak konečné prodloužení při 72 ° C / 5 minut. Produkty PCR byly analyzovány standardní elektroforézou na agarózovém gelu a produkty PCR byly čištěny pomocí QIAquick PCR purifikační soupravy (Qiagen) podle pokynů výrobce. Vzorky byly eluovány dvakrát ve 30 ul a eluáty z každého vzorku byly spojeny a sekvenovány ve 2 x v obou směrech za použití primerů, které generovaly produkty. Sekvenční reakce byly prováděny Eurofins / MGW / Operon (Huntsville, AL, USA).

 

4.5. Sekvenování celého genomu / metagenomické analýzy

Vzorky DNA byly nejprve vyhodnoceny pomocí eGel a PicoGreen fluorometrie v PerkinElmer DNA Sequencing a Analysis Services, aby se změřila kvalita, respektive kvantita. Vzorky DNA byly poté fyzicky stříhány na požadovanou velikost (300 – 1 000 bp) za použití Covaris (Woburn, MA, USA). E220 zaměřený ultrazvuk. Celé genomové knihovny byly připraveny za použití soupravy Illumina (San Diego, CA, USA) TruSeq podle pokynů výrobce. Sekvenování celého genomu bylo provedeno pomocí přístroje Illumina HiSeq2500. Nezpracovaná data sekvenování byla převedena do formátu FASTQ za použití Illumina BCL2FASTQ v. 1.82. Odečty byly zarovnány s lidskou referencí GRCh37 s Burrows® Wheeler Aligner (BWA), v. 0.6.2. ( http://bio-bwa.sourceforge.net ). Výsledné soubory zarovnání (bam) byly filtrovány pomocí Samtools (http://www.htslib.org ), chcete-li odebrat čtení, které je mapováno na lidskou referenci. Zbývající hodnoty byly poté filtrovány, aby se odstranily výsledky nízké kvality pomocí Trimmomatic ( http://www.usadellab.org/cms/?page=trimmomatic ). Zbývající vysoce kvalitní odečty byly poté mapovány pomocí BWA proti různým požadovaným bakteriálním referenčním genomům. Čtení, která mapovala sledované genomy, se poté použila pro vyhledávání BLAST.

 

4.6. Konfokální mikroskopie

Tkáňové řezy byly nejprve imunobarveny na Borrelia a alginát, jak je popsáno výše, a dále analyzovány pomocí konfokálního skenovacího laserového mikroskopu (Leica DMI6000). Software ImageJ (Imagej.nih.gov, https://imagej.nih.gov/ij/index.html) byl použit ke zpracování získaných z hromádek, aby poskytla podrobnou analýzu prostorové distribuce různých antigenů (Pluginy: Interaktivní 3D Prohlížeč plochy a zobrazení svazku).

 

4.7. Statistická analýza

Statistická analýza byla provedena pomocí Studentova t- testu (Microsoft Excel, Redmond, WA, USA) na počtu pozorovaných agregátů nalezených v pitevních tkáních mozku, srdce, ledvin a jater. Statistická významnost byla stanovena na základě p- hodnot <0,05.

5. Závěry

Stručně řečeno, tato studie poskytuje několik důkazů, že Borrelia může v lidském těle přetrvávat nejen ve spirochetální, ale také ve formě biofilmu rezistentní na antibiotika, a to i po dlouhodobé léčbě antibiotiky. Přítomnost infiltrujících lymfocytů v blízkosti biofilmů B. burgdorferi naznačuje, že biofilm by mohl vyvolat chronické zánětlivé reakce.

Doplňkové materiály

Následující dokumenty jsou k dispozici online na adrese https://www.mdpi.com/2079-6382/8/4/183/s1 , obrázek S1: Reprezentativní obrázky IHC barvení mozkových pitevních tkání pomocí Borrelia – a alginátově specifických protilátek., Obrázek S2: Reprezentativní obrazy IHC barvení srdečních tkání s Borrelia – a alginát-specifické protilátky, Obrázek S3: Reprezentativní obrazy IHC barvení ledvinových tkání s Borrelia – a alginát-specifické protilátky, Obrázek S4: Reprezentativní obrazy IHC barvení jater tkáně s Borrelia – a alginát-specifické protilátky, Obrázek S5: Reprezentativní obraz IHC barvení mozkové tkáně pro B. burgdorferi (červené zbarvení červenými šipkami) v místě mozkové vaskulitidy.

Příspěvky autora

Navržené experimenty: RSK, HI, AM, JEG a ES Provedené experimenty: RSK, HI, JPT, MO, GG a AM Analyzované údaje: AM, SM, KBL, JEG a ES Patologická analýza: JL a JEG Přispívající činidla / materiály / analytické nástroje: JPT, MO, SM, GG a AM Napsal a upravil rukopis: KBL, KE, JL, JEG a ES

Financování

Autoři děkují Global Lyme Alliance, LivLyme Foundation, Lyme Warriors a National Filanthropic Trust za podporu výzkumu uvedeného v tomto článku. Mikroskopy a fotoaparáty byly darovány Lymedisease.org, Schwartz Research Foundation a Global Lyme Alliance. Děkujeme také Dr. Akiko Nishiyama (University of Connecticut) za použití konfokálního mikroskopu Leica SP8 (cena NIH Shared and High Instrumentation Award # S10OD016435).

Střet zájmů

Autoři prohlašují, že nedochází ke střetu zájmů.

Reference

  1. Cook, M.J. Lyme borreliosis: A review of data on transmission time after tick attachment.  J. Gen. Med.20148, 1–8. [Google Scholar] [CrossRef]
  2. Kugeler, K.J.; Farley, G.M.; Forrester, J.D.; Mead, P.S. Geographic distribution and expansion of human Lyme disease, United States.  Infect. Dis.201521, 1455–1457. [Google Scholar] [CrossRef] [PubMed]
  3. Center of Disease Control and Prevention. Lyme Disease. 2018. Available online: https://www.cdc.gov/lyme/stats/humancases.html(accessed on 1 October 2019).
  4. Rosenberg, R. Vital Signs: Trends in reported vectorborne disease cases—United States and Territories, 2004–2016. MMWR Morb. Mortal. Wkly. Rep.201867. [Google Scholar] [CrossRef] [PubMed]
  5. Mac, S.; da Silva, S.R.; Sander, B. The economic burden of Lyme disease and the cost-effectiveness of Lyme disease interventions: A scoping review. PLoS ONE201914, e0210280. [Google Scholar] [CrossRef] [PubMed]
  6. Wormser, G.P.; Nadelman, R.B.; Dattwyler, R.J.; Dennis, D.T.; Shapiro, E.D.; Rush, T.J.; Rahn, D.W.; Coyle, P.K.; Persing, D.H.; Fish, D.; et al. Practice guidelines for the treatment of Lyme disease.  Infect. Dis.200031, S1–S14. [Google Scholar] [CrossRef] [PubMed]
  7. Dattwyler, R.J.; Wormser, G.P.; Rush, T.J.; Finkel, M.F.; Schoen, R.T.; Grunwaldt, E.; Franklin, M.; Hilton, E.; Bryant, G.L.; Agger, W.A.; et al. A comparison of two treatment regimens of ceftriaxone in late Lyme disease.  Klin. Wochenschr.2005117, 393–397. [Google Scholar] [CrossRef] [PubMed]
  8. Donta, S.T. Tetracycline therapy for chronic Lyme disease.  Infect. Dis.199725, S52–S56. [Google Scholar] [CrossRef]
  9. Eppes, S.C.; Childs, J.A. Comparative study of cefuroxime axetil versus amoxicillin in children with early Lyme disease. Pediatrics2002109, 1173–1177. [Google Scholar] [CrossRef]
  10. Preac-Mursic, V.; Weber, K.; Pfister, H.W.; Wilske, B.; Gross, B.; Baumann, A.; Prokop, J. Survival of Borrelia burgdorferiin antibiotically treated patients with Lyme borreliosis. Infection 198917, 355–359. [Google Scholar] [CrossRef]
  11. Liegner, K.B.; Rosenkilde, C.E.; Campbell, G.L.; Quan, T.J.; Dennis, D.T. Culture-confirmed treatment failure of cefotaxime and minocycline in a case of Lyme meningoencephalomyelitis in the United States. In Proceedings of the Program and Abstracts of the Fifth International Conference on Lyme Borreliosis, Arlington, VA, USA, 30 May–2 June 1992; Federation of American Societies for Experimental Biology: Bethesda, MD, USA, 1992; Volume A11. [Google Scholar]
  12. Liegner, K.B.; Shapiro, J.R.; Ramsay, D.; Halperin, A.J.; Hogrefe, W.; Kong, L. Recurrent erythema migrans despite extended antibiotic treatment with minocycline in a patient with persisting Borrelia burgdorferiJ. Am. Acad. Dermatol. 199328, 312–314. [Google Scholar] [CrossRef]
  13. Steere, A.C.; Angelis, S.M. Therapy for Lyme arthritis: Strategies for the treatment of antibiotic-refractory arthritis. Arthritis Rheum.200654, 3079–3086. [Google Scholar] [CrossRef] [PubMed]
  14. Klempner, M.S.; Baker, P.J.; Shapiro, E.D.; Marques, A.; Dattwyler, R.J.; Halperin, J.J.; Wormser, G.P. Treatment trials for post-lyme disease symptoms revisited.  J. Med.2013126, 665–669. [Google Scholar] [CrossRef] [PubMed]
  15. Post-Treatment Lyme Disease Syndrome. Centre of Disease Control and Prevention. Lyme Disease. 2019. Available online: https://www.cdc.gov/lyme/postlds/index.html(accessed on 25 September 2019).
  16. Hodzic, E.; Feng, S.; Holden, K.; Freet, K.J.; Barthold, S.W. Persistence of Borrelia burgdorferifollowing antibiotic treatment in mice.  Agents Chemother. 200852, 1728–1736. [Google Scholar] [CrossRef] [PubMed]
  17. Hodzic, E.; Imai, D.; Feng, S.; Barthold, S.W. Resurgence of persisting non-cultivable Borreliaburgdorferi following antibiotic treatment in mice. PLoS ONE 20149, e86907. [Google Scholar] [CrossRef] [PubMed]
  18. Straubinger, R.K.; Summers, B.A.; Chang, Y.F.; Appel, M.J. Persistence of Borrelia burgdorferiin experimentally infected dogs after antibiotic treatment.  Clin. Microbiol. 199735, 111–116. [Google Scholar] [PubMed]
  19. Berndtson, K. Review of evidence for immune evasion and persistent infection in Lyme disease.  J. Gen. Med.20136, 291–306. [Google Scholar] [CrossRef] [PubMed]
  20. Embers, M.E.; Barthold, S.W.; Borda, J.T.; Bowers, L.; Doyle, L.; Hodžić, E.; Jacobs, M.B.; Hasenkampf, N.R.; Martin, D.S.; Narasimhan, S.; et al. Persistence of Borrelia burgdorferiin Rhesus Macaques following antibiotic treatment of disseminated infection. PLoS ONE 20127, e29914. [Google Scholar] [CrossRef]
  21. Embers, M.E.; Hasenkampf, N.R.; Jacobs, M.B.; Tardo, A.C.; Doyle-Meyers, L.A.; Philipp, M.T.; Hodzic, E. Variable manifestations, diverse seroreactivity and post-treatment persistence in non-human primates exposed to Borrelia burgdorferiby tick feeding. PLoS ONE 201712, e0189071. [Google Scholar] [CrossRef]
  22. Crossland, N.A.; Alvarez, X.; Embers, M.E. Late disseminated Lyme disease: Associated pathology and spirochete persistence posttreatment in Rhesus Macaques J. Pathol.2018188, 672–682. [Google Scholar] [CrossRef]
  23. Hodzic, E.; Imai, D.M.; Escobar, E. The generality of post-antimicrobial treatment persistence of Borrelia burgdorferistrains N40 and B31 in genetically susceptible and resistant mouse strains.  Immun. 2019, IAI.00442-19. [Google Scholar] [CrossRef]
  24. Feng, J.; Li, T.; Yuan, Y.; Yee, R.; Zhang, Y. Biofilm/persister/stationary phase bacteria cause more severe disease than log phase bacteria—Biofilm Borrelia burgdorferinot only display more tolerance to Lyme antibiotics but also cause more severe pathology in a mouse arthritis model: Implications for understanding persistence, PTLDS and treatment failure.  Med. 2019148, 125–138. [Google Scholar]
  25. Schmidli, J.; Hunziker, T.; Moesli, P.; Schaad, U.B. Cultivation of Borrelia burgdorferifrom joint fluid three months after treatment of facial palsy due to Lyme borreliosis.  Infect. Dis. 1988158, 905–906. [Google Scholar] [CrossRef] [PubMed]
  26. Häupl, T.; Hahn, G.; Rittig, M.; Krause, A.; Schoerner, C.; Schönherr, U.; Kalden, J.R.; Burmester, G.R. Persistence of Borrelia burgdorferiin ligamentous tissue from a patient with chronic Lyme borreliosis.  Rheum. 199336, 1621–1626. [Google Scholar] [CrossRef] [PubMed]
  27. Battafarano, D.F.; Combs, J.A.; Enzenauer, R.J.; Fitzpatrick, J.E. Chronic septic arthritis caused by Borrelia burgdorferi Orthop. Relat. Res.1993297, 238–241. [Google Scholar]
  28. Middelveen, M.J.; Sapi, E.; Burke, J.; Filush, K.R.; Franco, A.; Fesler, M.C.; Stricker, R.B. Persistent Borreliainfection in patients with ongoing symptoms of Lyme disease. Healthcare 20186, 33. [Google Scholar] [CrossRef]
  29. Brorson, O.; Brorson, S.H. Transformation of cystic forms of Borrelia burgdorferito normal, mobile spirochetes. Infection 199725, 240–246. [Google Scholar] [CrossRef]
  30. MacDonald, A.B. Spirochetal cyst forms in neurodegenerative disorders, … hiding in plain sight.  Med. Hypotheses200667, 819–832. [Google Scholar] [CrossRef]
  31. Brorson, Ø.; Brorson, S.H.; Scythes, J.; MacAllister, J.; Wier, A.; Margulis, L. Destruction of spirochete Borrelia burgdorferiround-body propagules (RBs) by the antibiotic tigecycline.  Natl. Acad. Sci. USA 2009106, 18656–18661. [Google Scholar] [CrossRef]
  32. Barthold, S.W.; Hodzic, E.; Imai, D.M.; Feng, S.; Yang, X.; Luft, B.J. Ineffectiveness of tigecycline against persistent Borrelia burgdorferi Agents. Chemother.201054, 643–651. [Google Scholar] [CrossRef]
  33. Costerton, J.W.; Stewart, P.S.; Greenberg, E.P. Bacterial biofilms: A common cause of persistent infections. Science1999284, 1318–1322. [Google Scholar] [CrossRef]
  34. Sutherland, I. Biofilm exopolysaccharides: A strong and sticky framework. Microbiology2001147, 3–9. [Google Scholar] [CrossRef] [PubMed]
  35. Lopes, S.P.; Ceri, H.; Azevedo, N.F.; Pereira, M.O. Antibiotic resistance of mixed biofilms in cystic fibrosis: Impact of emerging microorganisms on treatment of infection.  J. Antimicrob. Agents201240, 260–263. [Google Scholar] [CrossRef] [PubMed]
  36. Römling, U.; Balsalobre, C. Biofilm infections, their resilience to therapy and innovative treatment strategies.  Intern. Med.2012272, 541–561. [Google Scholar] [CrossRef] [PubMed]
  37. Sun, F.; Qu, F.; Ling, Y.; Mao, P.; Xia, P.; Chen, H.; Zhou, D. Biofilm-associated infections: Antibiotic resistance and novel therapeutic strategies. Future Microbiol.20138, 877–886. [Google Scholar] [CrossRef] [PubMed]
  38. Hall, C.W.; Mah, T.F. Molecular mechanisms of biofilm-based antibiotic resistance and tolerance in pathogenic bacteria. FEMS Microbiol. Rev.201741, 276–301. [Google Scholar] [CrossRef]
  39. Algburi, A.; Comito, N.; Kashtanov, D.; Leon, M.T.; Dicks, L.M.T.; Chikindas, M.L. Control of biofilm formation: Antibiotics and beyond.  Environ. Microbiol.201783, e02508-16. [Google Scholar] [CrossRef]
  40. Ciofu, O.; Tolker-Nielsen, T. Tolerance and resistance of Pseudomonas aeruginosabiofilms to antimicrobial agents—How  aeruginosa can escape antibiotics. Front. Microbiol. 201910, 913. [Google Scholar] [CrossRef] [PubMed]
  41. Sapi, E.; Bastian, S.L.; Mpoy, C.M.; Scott, S.; Rattelle, A.; Pabbati, N.; Poruri, A.; Burugu, D.; Theophilus, P.A.S.; Pham, T.V.; et al. Characterization of biofilm formation by Borrelia burgdorferiin vitro. PLoS ONE 20127, e48277. [Google Scholar] [CrossRef] [PubMed]
  42. Timmaraju, V.A.; Theophilus, P.A.S.; Balasubramanian, K.; Shakih, S.; Luecke, D.F.; Sapi, E. Biofilm formation by Borrelia sensu latoFEMS Microbiol. Lett.2015362, fnv120. [Google Scholar] [CrossRef]
  43. Sapi, E.; Balasubramanian, K.; Poruri, A.; Maghsoudlou, J.S.; Socarras, K.M.; Timmaraju, A.V.; Filush, K.R.; Gupta, K.; Shaikh, S.; Theophilus, P.A.S.; et al. Evidence of in vivo existence of Borreliabiofilm in Borrelial lymphocytomas.  J. Microbiol. Immunol. 20166, 9–24. [Google Scholar] [CrossRef]
  44. Sapi, E.; Kaur, N.; Anyanwu, S.; Datar, A.; Patel, S.; Rossi, J.M.; Stricker, R.B. Evaluation of in vitroantibiotic susceptibility of different morphological forms of Borrelia burgdorferi Drug. Resist. 20114, 97–113. [Google Scholar] [PubMed]
  45. Theophilus, P.A.S.; Victoria, M.J.; Socarras, K.M.; Filush, K.R.; Gupta, K.; Luecke, D.F.; Sapi, E. Effectiveness of Stevia rebaudianawhole leaf extract against the various morphological forms of Borrelia burgdorferi in vitro.  J. Microbiol. Immunol. 20155, 268–280. [Google Scholar] [CrossRef] [PubMed]
  46. Soccaras, K.M.; Theophilus, P.A.S.; Torres, J.P.; Gupta, K.; Sapi, E. Antimicrobial activity of bee venom and mellittin against BorreliaAntibiotics20176, 31. [Google Scholar] [CrossRef] [PubMed]
  47. Liegner, K.B. Lyme Disease: The sensible pursuit of answers. (Guest commentary).  Clin. Microbiol.199331, 1961–1963. [Google Scholar] [PubMed]
  48. Liegner, K.B.; Duray, P.; Agricola, M.; Rosenkilde, C.; Yannuzzi, L.; Ziska, M.; Tilton, R.; Hulinska, D.; Hubbard, J.; Fallon, B. Lyme disease and the clinical spectrum of antibiotic-responsive chronic meningoencephalomyelitides.  Spirochetal Tick-Borne Dis.19974, 61–73. [Google Scholar]
  49. Liegner, K.B. In the Crucible of Chronic Lyme Disease. Collected Writings & Associated Materials; Library of Congress Control Number: 2015911615; Xlibris: Bloomington, IN, USA, 2015. [Google Scholar]
  50. Eisendle, K.; Grabner, T.; Zelger, B. Focus floating microscopy: “Gold Standard” for cutaneous Borreliosis?  J. Clin. Pathol.2007127, 213–222. [Google Scholar] [CrossRef] [PubMed]
  51. Marques, A.R. Laboratory diagnosis of Lyme disease: Advances and challenges.  Dis. Clin. N. Am.201529, 295–307. [Google Scholar] [CrossRef] [PubMed]
  52. Bispo, P.J.; Haas, W.; Gilmore, M.S. Biofilms in infections of the eye. Pathogens20154, 111–136. [Google Scholar] [CrossRef]
  53. González, M.J.; Robino, L.; Iribarnegaray, V.; Zunino, P.; Paola Scavone, P. Effect of different antibiotics on biofilm produced by uropathogenic Escherichia coliisolated from children with urinary tract infection.  Dis. 201775, ftx053. [Google Scholar] [CrossRef]
  54. Junka, A.; Szymczyk, P.; Ziółkowski, G.; Karuga-Kuzniewska, E.; Smutnicka, D.; Bil-Lula, I.; Bartoszewicz, M.; Mahabady, S.; Sedghizadeh, P.P. Bad to the bone: On in vitro and ex vivo microbial biofilm ability to directly destroy colonized bone surfaces without participation of host immunity or osteoclastogenesis. PLoS ONE201712, e0169565. [Google Scholar] [CrossRef]
  55. Guerrero, M.L.F.; López, J.J.G.; Goyenechea, A.; Fraile, J.; de Górgolas, M. Endocarditis caused by Staphylococcus aureus. A reappraisal of the epidemiologic, clinical, and pathologic manifestations with analysis of factors determining outcome. Medicine200988, 1–22. [Google Scholar] [CrossRef] [PubMed]
  56. Chao, Y.; Marks, L.R.; Pettigrew, M.M.; Hakansson, A.P. Streptococcus pneumoniaebiofilm formation and dispersion during colonization and disease.  Cell Infect. Microbiol. 20154, 194. [Google Scholar] [CrossRef] [PubMed]
  57. Moser, C.; Pedersen, H.T.; Lerche, C.J.; Kolpen, M.; Line, L.; Thomsen, K.; Høiby, N.; Jensen, P.Ø. Biofilms and host response—Helpful or harmful. Apmis2017125, 320–338. [Google Scholar] [CrossRef] [PubMed]
  58. Ciofu, O.; Rojo-Molinero, E.; Macià, M.D.; Oliver, A. Antibiotic treatment of biofilm infections. Apmis2017125, 304–319. [Google Scholar] [CrossRef] [PubMed]
  59. Bockenstedt, L.K.; Gonzalez, D.G.; Haberman, A.M.; Belperron, A.A. Spirochete antigens persist near cartilage after murine Lyme borreliosis therapy.  Clin. Investig.2012122, 2652–2660. [Google Scholar] [CrossRef] [PubMed]
  60. Jutras, B.L.; Lochhead, R.B.; Kloos, Z.A.; Biboy, J.; Strle, K.; Booth, C.J.; Govers, S.K.; Gray, J.; Schumann, P.; Vollmer, W.; et al. Borrelia burgdorferipeptidoglycan is a persistent antigen in patients with Lyme arthritis.  Natl. Acad. Sci. USA 2019116, 13498–13507. [Google Scholar] [CrossRef] [PubMed]
  61. Dalldorf, F.G.; Cromartie, W.J.; Anderle, S.K.; Clark, R.L.; Schwab, J.H. The relation of experimental arthritis to the distribution of streptococcal cell wall fragments.  J. Pathol.1980100, 383–402. [Google Scholar] [PubMed]
  62. Lo, Y.M.; Zhang, J.; Leung, T.N.; Lau, T.K.; Chang, A.M.; Hjelm, N.M. Rapid clearance of fetal DNA from maternal plasma.  J. Hum. Genet.199964, 218–224. [Google Scholar] [CrossRef] [PubMed]
  63. Malawista, S.E.; Barthold, S.W.; Persing, D.H. Fate of Borreliaburgdorferi DNA in tissues of infected 537 mice after antibiotic treatment.  Infect. Dis. 1994170, 1312–1316. [Google Scholar] [CrossRef] [PubMed]
  64. Lazarus, J.J.; McCarter, A.L.; Neifer-Sadhwani, K.; Wooten, R.M. ELISA-based measurement of antibody responses and PCR-based detection profiles can distinguish between active infection and early clearance of Borrelia burgdorferi Dev. Immunol.20122012, 138069. [Google Scholar] [CrossRef]
  65. Meurers, B.; Kohlhepp, W.; Gold, R.; Rohrbach, E.; Mertens, H.G. Histopathological findings in the central and peripheral nervous systems in neuroborreliosis. A report of three cases.  Neurol.1990237, 113–116. [Google Scholar] [CrossRef] [PubMed]
  66. Miklossy, J.; Kuntzer, T.; Bogousslavky, J.; Regli, F.; Janzer, R.C. Meningovascular form of neuroborreliosis: Similarities between neuropathological findings in a case of Lyme disease and those occurring in tertiary neurosyphilis. Acta Neuropathol.199080, 568–572. [Google Scholar] [CrossRef] [PubMed]
  67. Oksi, J.; Kalimo, H.; Marttila, R.J.; Marjamaki, M.; Sonninen, P.; Nikoskelainen, J.; Viljanen, M.K. Inflammatory brain changes in Lyme borreliosis: A report on three patients and review of literature. Brain1996119, 2143–2154. [Google Scholar] [CrossRef] [PubMed]
  68. Uldry, P.A.; Regli, F.; Bogousslavsky, J. Cerebral angiopathy and recurrent strokes following Borreliaburgdorferi infection.  Neurol. Neurosurg Psychiatry 198750, 1703–1704. [Google Scholar] [CrossRef] [PubMed]
  69. Olsson, J.; Zbornikova, V. Neuroborreliosis simulating a progressive stroke.  Neurol. Scand.199081, 471–474. [Google Scholar] [CrossRef] [PubMed]
  70. Miklossy, J. Biology and neuropathology of dementia in syphilis and Lyme disease.  Clin. Neurol.200889, 825–844. [Google Scholar] [CrossRef] [PubMed]
  71. Tracy, K.E.; Baumgarth, N. Borrelia burgdorferimanipulates innate and adaptive immunity to establish persistence in rodent reservoir hosts.  Immunol. 20178, 116. [Google Scholar] [CrossRef] [PubMed]
  72. González, J.F.; Hahn, M.M.; Gunn, J.S. Chronic biofilm-based infections: Skewing of the immune response.  Dis.201876, fty023. [Google Scholar] [CrossRef]
  73. Cai, S.; Li, Y.; Wang, K.; Cen, Y.; Lu, H.; Dong, B.; Chen, Y.; Kong, J. Pathogenic effects of biofilm on Pseudomonas aeruginosapulmonary infection and its relationship to cytokines.  Sci. Monit. 2016, 4869–4874. [Google Scholar] [CrossRef]
  74. Gurjala, A.N.; Geringer, M.R.; Seth, A.K.; Hong, S.J.; Smeltzer, M.S.; Galiano, R.D.; Leung, K.P.; Mustoe, T.A. Development of a novel, highly quantitative in vivo model for the study of biofilm-impaired cutaneous wound healing. Wound Repair Regen.201119, 400–410. [Google Scholar] [CrossRef]
  75. Seth, A.; Geringer, M.; Gurjala, A.; Hong, S.; Galiano, R.; Leung, K.; Mustoe, T. Treatment of Pseudomonas aeruginosabiofilm- Infected wounds with clinical wound strategies: A quantitative study using an in vivo rabbit ear model.  Reconstr. Surg. 2014129, 262e–274e. [Google Scholar] [CrossRef] [PubMed]
  76. Hu, H.; Jacombs, A.; Vickery, K.; Merten, S.L.; Pennington, D.G.; Deva, A.K. Chronic biofilm infection in breast implants is associated with an increased T-cell lymphocytic infiltrate: Implications for breast implant-associated lymphoma.  Reconst. Surg.2015135, 319–329. [Google Scholar] [CrossRef] [PubMed]

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).

 

trombotické komplikace očkování – dá se s tím něco dělat?

Níže jsem zkopíroval překlad dopisu dr. Noorchashma pro FDA (ztaženo z rozalio.cz – originál pod textem) a je tam link i na článek z Lancetu o vlivu viru SARS-COV2 na endotel. Co z toho vyplývá?

  1.  Neočkovat se, když neuplyne dostatek času od prodělaného onemocnění COVID 19, aspoň 3 měsíce
  2.  Kdo si není jist, zda měl COVID a kdy, nechat si vzít hladinu protilátek
  3.  návrh preventivní medikace: Aspirin 100mg denně, po celou dobu očkování
  4.  vysadit hormonální antikoncepci před i po očkování
  5.  nekouřit, dostatek tekutin a zdravě jíst
  6.  u vysoce rizikových pacientů (v minulosti prodělaná trombóza, plicní embolie, trombofilie) užívat preventivně LMWH, např. Clexane 0,4 1x denně
  7.  z potravinových doplňků – vitamín C, Kurkumin, Glutathion, N-acetylcystein
  8.  zvážit podání statinů – léků na cholesterol, který mají potenciál stabilizovat endotel cévní
  9. u pacientů s vyšším rizikem, např. ischemická choroba srdeční, kuřáci, pacienti s trombembolismem v anamnéze zvážit Colchicin 1x denně po celou dobu očkování

 

Dopis kardiochirurga Hoomana Noorchashma expertům z Úřadu pro kontrolu potravin a léčiv (FDA) a firmy Pfizer ze dne 26. ledna 2021

Obracím se na vás jakožto na naše přední odborníky na veřejné zdraví a představitele regulačního úřadu s následujícím varováním a téměř jistou prognózou.
Virus SARS-CoV-2 vykazuje, mimo jiné tkáně a orgány, tropismus pro vaskulární endotel. Tuto skutečnost popisuje článek v odborném časopise Lancet publikovaný v dubnu 2020: https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30937-5/fulltext

Receptor ACE-2 na endotelu zřejmě představuje bránu pro vstup viru do endoteliálních buněk, přičemž to vypadá, že endoteliální poranění způsobené virem nebo zánětlivou reakcí, kterou vyvolává, je důvodem, proč mnoho pacientů s COVID-19 má tromboembolické komplikace.
S jistotou tak lze prohlásit, že virové antigeny jsou přítomny v endoteliální výstelce cév u všech osob, které jsou aktuálně nebo nedávno byly nakažené virem SARS-CoV-2, bez ohledu na to, zda jsou symptomatické nebo rekonvalescentní.

Chci vás tímto upozornit na téměř jistou imunologickou prognózu, že jsou-li virové antigeny přítomny v tkáních (jakýchkoli) osob, které podstupují očkování, bude antigenově specifická imunitní reakce vyvolaná vakcínou cílit na tyto tkáně a způsobovat zánět a poškození i mimo místo samotné vakcinace.
Pokud jsou virové antigeny přítomny ve vaskulárním endotelu či jiných vrstvách cév, zejména u starších a oslabených osob trpících kardiovaskulárním onemocněním, pak antigenově specifická imunitní odpověď vyvolaná vakcínou téměř jisté poškodí vaskulární endotel. Endoteliální zánět vyvolaný vakcínou bezpochyby povede k vytvoření krevní sraženiny s potenciálem velkých tromboembolických komplikací, přinejmenším u podskupiny těchto pacientů. Pro většinu mladších, silnějších pacientů takové vaskulární poranění z imunitní odpovědi na vakcínu nepředstavuje vážné ohrožení, pro mnohé starší a slabé pacienty s kardiovaskulárním onemocněním však ano.

Proto vás uctivě žádám, aby FDA ve spolupráci s firmami Pfizer a Moderna okamžitě vydal jasné doporučení klinickým lékařům: odložit imunizaci u všech nedávno rekonvalescentních pacientů stejně jako u všech známých symptomatických nebo asymptomatických přenašečů a před očkováním aktivně vyšetřit co nejvíce pacientů s vysokým kardiovaskulárním rizikem, aby bylo možné detekovat přítomnost SARS-CoV-2.
Potenciálním rozumným řešením, zejména v domovech s pečovatelskou službou, by bylo screeningové vyšetření protilátek coby náhradního prostředku k vyloučení/odložení očkování u osob, které mohly být viru vystaveny a v jejichž tkáních zůstaly virové antigeny.

Cílem v oblasti veřejného zdraví je co nejrozsáhlejší a rychlé očkování populace. Zachrání to mnoho životů a pravděpodobně i náš národ; očkování na celostátní úrovni určitě zachrání mnohem více životů, než by jakákoli komplikace související s vakcínami mohla ohrozit. Přestože víme, že většina našich občanů bude mít v současné krizové situaci z očkování prospěch, nemůžeme tím ospravedlnit regulační a korporátní selhání při zmírňování známých a racionálně předpovězených nebezpečí pro ohroženou menšinovou skupinu osob.

Jelikož coby imunolog dobře vím, jak antigenově specifické imunitní odpovědi mohou způsobit poškození orgánů a tkání, doporučuji vám, jako našim hlavním regulátorům FDA, nepřehlížet skutečnost, že očkování osob s již existujícími SARS-CoV-2 virovými antigeny ve tkáních by jim mohlo způsobit vážné poškození, zejména oslabeným jedincům trpícím kardiovaskulárními nemocemi.

Pokud se navíc imunologické riziko, které zde předpovídám, ukáže jako závažné, tak v příštích měsících, kdy budou naočkovány další miliony Američanů, bude zřetelní i pro veřejnost.

Dokážete si představit, že si veřejnost, aniž by od FDA dostala jakékoli varování, začne uvědomovat rostoucí počet takových vaskulárních/tromboembolických komplikací? Jak se poté podle vás změní úroveň „váhavosti vůči očkování“? Nepožene pak veřejnost odborníky a federální regulační orgány k zodpovědnosti, zejména pokud o existenci tohoto imunologického nebezpečí věděli, nebo měli vědět?

Zajistit prospěch většině veřejnosti a zachránit národ před touto pandemií rychlým a agresivním očkováním je eticky správný cíl, pokud však víme o skutečných či pravděpodobných rizicích újmy a úmrtnosti, měli bychom výrazně zmírnit rizika pro ohrožené osoby. To je jediná rozumná, etická a pravděpodobně legální cesta, kterou se můžete jako regulační orgány v oblasti veřejného zdraví vydat, jelikož v USA již neobětujeme životy menšinových podskupin lidí ve prospěch většiny. Zaměřujeme se na etické dosažení rovnováhy mezi blahem pro většinu a obranou práv jednotlivce na život a svobodu a vlastnických práv.

 

https://www.thelancet.com/journals/lancet/article/PIIS0140-6736(20)30937-5/fulltext

https://noorchashm.medium.com/a-letter-of-warning-to-fda-and-pfizer-on-the-immunological-danger-of-covid-19-vaccination-in-the-7d17d037982d

colchicin – nadějný lék COVID 19

Níže uvádím stručný závěr studie – dvojitě zaslepené, randomizované a na velkém počtu pacientů, prokazující, že podání colchicinu 25mg 1-0-1 3 dny a potom 1x denně snížilo počet úmrtí na COVID 19.

Colchicin je starý dobrý lék, používá se v revmatologii, na akutní dnavý záchvat a nyní i po prodělaném infarktu. Je velmi bezpečný, ve vyšších dávkách, např. 6 tbl denně vyvolává průjmy, ale v té malé dávce 1-0-1, či jedenkrát denně, je bez výraznějších nežádoucích účinků.

Tak proč to nezkusit!!!

Efficacy of Colchicine in Non-Hospitalized Patients with COVID-19

Jean-Claude TardifNadia BouabdallaouiPhilippe L. L’AllierDaniel GaudetBinita ShahMichael H. PillingerJose Lopez-SendonProtasio da LuzLucie VerretSylvia AudetJocelyn DupuisAndré DenaultMartin PelletierPhilippe A. TessierSarah SamsonDenis FortinJean-Daniel TardifDavid BusseuilElisabeth GouletChantal LacosteAnick DuboisAvni Y. JoshiDavid D. WatersPriscilla HsueNorman E. LeporFrédéric LesageNicolas SainturetEve Roy-ClavelZohar BassevitchAndreas OrfanosJean C. GrégoireLambert BusqueChristian LavalléePierre-Olivier HétuJean-Sébastien PaquetteSylvie LevesqueMariève CossetteAnna NozzaMalorie Chabot-BlanchetMarie-Pierre DubéMarie-Claude GuertinGuy Boivinfor the COLCORONA Investigators

ABSTRACT

Background Evidence suggests the role of an inflammatory storm in COVID-19 complications. Colchicine is an orally administered, anti-inflammatory medication beneficial in gout, pericarditis and coronary disease.

Methods We performed a randomized, double-blind trial involving non-hospitalized patients with COVID-19 diagnosed by polymerase chain reaction (PCR) testing or clinical criteria. The patients were randomly assigned to receive colchicine (0.5 mg twice daily for 3 days and once daily thereafter) or placebo for 30 days. The primary efficacy endpoint was the composite of death or hospitalization for COVID-19.

Results A total of 4488 patients were enrolled. The primary endpoint occurred in 4.7% of the patients in the colchicine group and 5.8% of those in the placebo group (odds ratio, 0.79; 95.1% confidence interval (CI), 0.61 to 1.03; P=0.08). Among the 4159 patients with PCR-confirmed COVID-19, the primary endpoint occurred in 4.6% and 6.0% of patients in the colchicine and placebo groups, respectively (odds ratio, 0.75; 95% CI, 0.57 to 0.99; P=0.04). In these patients with PCR-confirmed COVID-19, the odds ratios were 0.75 (95% CI, 0.57 to 0.99) for hospitalization due to COVID-19, 0.50 (95% CI, 0.23 to 1.07) for mechanical ventilation, and 0.56 (95% CI, 0.19 to 1.66) for death. Serious adverse events were reported in 4.9% and 6.3% in the colchicine and placebo groups (P=0.05); pneumonia occurred in 2.9% and 4.1% of patients (P=0.02). Diarrhea was reported in 13.7% and 7.3% in the colchicine and placebo groups (P<0.0001).

Conclusion Among non-hospitalized patients with COVID-19, colchicine reduces the composite rate of death or hospitalization. (COLCORONA ClinicalTrials.gov number: NCT04322682)

Competing Interest Statement

JCT reports grants from Government of Quebec, National Heart, Lung, and Blood Institute of the U.S. National Institutes of Health (NIH), the Montreal Heart Institute Foundation, from Bill and Melinda Gates Foundation, Amarin, Esperion, Ionis, Servier, RegenXBio; personal fees from Astra Zeneca, Sanofi, Servier; and personal fees and minor equity interest from Dalcor. In addition, JCT’s institution has submitted a patent Methods of treating a coronavirus infection using Colchicine pending and a patent Early administration of low-dose colchicine after myocardial infarction pending. JCT has waived his rights in all patents related to colchicine and does not stand to benefit financially if colchicine becomes used as a treatment for COVID-19. MPD and JCT have a patent Methods for Treating or Preventing Cardiovascular Disorders and Lowering Risk of Cardiovascular Events issued to Dalcor, no royalties received, a patent Genetic Markers for Predicting Responsiveness to Therapy with HDL-Raising or HDL Mimicking Agent issued to Dalcor, no royalties received, and a patent Methods for using low dose colchicine after myocardial infarction with royalties paid to Invention assigned to the Montreal Heart Institute. NB reports personal fees from AstraZeneca; BS reports grants from NIH NHLBI; MHP reports grants from Hikma Pharmaceuticals, Horizon Therapeutics, and personal fees from Horizon Therapeutics; JLS reports grants from Bayer, Pfizer, Amgen, Boheringer Ingelheim and personal fees from Menarini; AYD reports personal fees from CAE Healthcare and Masimo, grants from Edwards; PH reports grants from NIH, Montreal Heart Institute, Gilead, and other from Merck; AO reports grants from the COVID-19 Therapeutics Accelerator; JSP reports personal fees from Universite Laval; MPD reports personal fees and other from Dalcor and personal fees from GlaxoSmithKline, other from AstraZeneca, Pfizer, Servier, Sanofi. Other authors have nothing to declare.

Clinical Trial

NCT04322682

Funding Statement

The study was funded by the Government of Quebec, the Bill and Melinda Gates Foundation, the National Institutes of Health and philanthropist Sophie Desmarais. The study medication and matching placebo were provided by Pharmascience (Montreal), which had no role in the design or conduct of the trial or the preparation or review of the manuscript. The first author (JCT) and lead statistician (MCG) prepared the first draft of the manuscript, had full access to the trial database, generated statistical analyses, made the decision to submit the manuscript for publication, and assume responsibility for the accuracy and completeness of the data and analyses and for the fidelity to the protocol.

Author Declarations

I confirm all relevant ethical guidelines have been followed, and any necessary IRB and/or ethics committee approvals have been obtained.

Yes

The details of the IRB/oversight body that provided approval or exemption for the research described are given below:

The protocol was approved by the Montreal Heart Institute research ethics committee and all institutional review boards at all centers involved in the 6 countries that participated in the trial.

All necessary patient/participant consent has been obtained and the appropriate institutional forms have been archived.

Yes

I understand that all clinical trials and any other prospective interventional studies must be registered with an ICMJE-approved registry, such as ClinicalTrials.gov. I confirm that any such study reported in the manuscript has been registered and the trial registration ID is provided (note: if posting a prospective study registered retrospectively, please provide a statement in the trial ID field explaining why the study was not registered in advance).

Yes

I have followed all appropriate research reporting guidelines and uploaded the relevant EQUATOR Network research reporting checklist(s) and other pertinent material as supplementary files, if applicable.

Yes

Paper in collection COVID-19 SARS-CoV-2 preprints from medRxiv and bioRxiv

Jak léčit COVID 19 v ambulantní péči

Jak léčit Covid 19 – protokol II – ABCD – EF

 

Profylaxe: po rizikovém kontaktu, či pobytu ve společné domácnosti s nakaženým

Ivermektin – 12-16mg jednorázově, za tři dny zopakovat

Isoprinosin 1-0-1 10 dní

Zinkorot 1-0-1,

Vitamín C 500mg denně + další potravinové doplňky, viz níže

(poznámka: ani Ivermectin, ani Isoprinosine zatím nejsou oficiálně doporučené léky a nemají zatím jednoznačně prokázaná data. Po Isoprinosinu bývají někdy zažívací potíže. Je to tedy na zvážení lékaře a Vás)

Od vypuknutí příznaků:

 

Ivermectin 0,2mg/kg (12-16mg) denně 5 dní po sobě, u obézních úvodem 0,3-0,4mg/Kg

Isoprinosin 2-2-2 5 dní – ale osobně s ním mám rozporuplné zkušenosti, někomu výborně zabere, někomu vůbec, někdo z něj má i zažívací potíže, osobně to nikomu nenutím, ale když to někdo chce vyzkoušet, nebráním mu. Jsou to dost velké a hořké tablety, takže kdo má nevolnosti, nechutenství, bývá mu z toho zle.

Acetylsalicylová Kyselina 500mg denně do ústupu příznaků

Budesonid (Budiair) inhalátor 2×2 vdechy do ústupu příznaků

Colchicin – 1-0-1 3 dny, potom měsíc 1x denně (dle celkového stavu, bezpříznakoví mohou vysadit dříve)

 

Expektorantia – ACC long 600 1-0-0 (nekombinovat s paracetamolem), nebo Erdomed, či Soledum

Famosan 40mg 0-0-1 – při zlepšení stavu snížit na 20mg 0-0-1 a užívat po dobu užívání Kyseliny Acetylsalicylové. Dá se použít i omeprazol, pantoprazol, lanzoprazol.

 

Vitamín C  1000mg 1-0-1, po zlepšení snížit na 500mg denně

Vitamín D 5000I.U denně, zvláště u obézních pacientů, či u pacientů s hypovitaminózou vit. D, nebo ti, co dlouho vit. D nebrali, je vhodná úvodem i jednorázově větší dávka vitamínu D, např. 30000 IU

Zinkorot 25mg  2-0-2 ( po 5. dnech snížit na 1-0-1)

 

Dále doporučeno brát potravinové doplňky –

Quercetin + Bromelain 250 1-0-1, Melatonin 10mg před spaním

Selen  vitamíny B, Cistus Incanus -Růže středomořská, Andrographis – Pravenka LatnatáKurkuminGluthation

 

Na suchý vyčerpávající kašel Codein 30mg 1-1-1, či Levopront

Při teplotách, bolestech hlavy a svalů – Paracetamol 500 mg á 6 hodin, možno i střídavě s Ibuprofen 400mg á 8 hodin, anebo Novalgin á 8 hodin

 

Při zhoršování stavu v dalších dnech, hlavně stran dušnosti (doporučit lidem zakoupení prstového oximetru, varovný je hlavně pokles saturace pod 92%),  je dobré kontaktovat svého ošetřujícího lékaře, pokud to jde, domluvit si návštěvu, vzít hladinu CRP, D-dimerů, prokalcitoninu, změřit saturaci, popřípadě RTG plic, dle nálezu lze pokračovat:

Dexametazon 4mg – 12mg 1-0-0 dle tíže příznaků, důležité nasadit při rozvoji atypického zápalu plic, ten se zjistí poslechem, rtg, či CT. Kortikoidy u lehčích stavů lze nasadit i ambulantně, nelepší-li se stav několik dní, při poklesu saturace, oboustranném zápalu plic, je vhodnější za hospitalizace. Velmi dobrou alternativou Fortekortinu je Medrol tbl. Dávka je hodně individuální, ale nebojím se první dny jít do vyšších dávek a pak postupně snižovat. Kortikoidy jsou dobré v malé dávce dlouhodobě po prodělaném covidovém zápalu plic, např. Medrol 4mg denně, klidně celý měsíc.

Azithromycin 2 balení 1. den 1-0-1, dále 1-0-0, dá se i Amoksiklav 1 g á 12 hodin,  Zinnat 500mg á 12 hodin, či Klacid 500mg á 12 hodin. Antibiotika ale mají smysl většinou až později. Rozhodně bych je nenasazoval na počátku nemoci, a když je nízká hladina CRP a Prokalcitoninu. Mají smysl spíše na doléčení, trvají – li teploty a kašel delší dobu a berou-li se kortikoidy, které zvyšují riziko bakteriální superinfekce. Na to doléčení se dá použít i Biseptol a Doxycyklin

LMWH místo kys. acetylasalicylové v profylaktické dávce, např. Clexane 0,4ml (zvláště u rizikovějších pacientů  –  antikoncepce, TEN v anam.)

 

při dalším zhoršování stavu a zvláště poklesu saturace pod 92% nutná hospitalizace !!!

 

v případě, že dojdou místa v nemocnicích pokračovat v léčbě doma navýšením kortikoidů –

SoluMedrol 126 mg denně i.v. a postupně snižovat

LMWH v plné dávce

oxygenoterapie dle místních možností (koncentrátory kyslíku pro domácí použití)

 

kdo se může registrovat na očkování u praktického lékaře

Primárně se budou objednávat (registrovat) pacienti dle věkového kritéria, které je nyní 65+.

Ovšem praktickým lékařům je otevřena i možnost očkovat pacienty nemocné, mladší  let, mají-li přidružené choroby.

Jde o „pacienty, u nichž PL vyhodnotí, že jejich riziko vážného průběhu nemoci covid-19 je obdobné riziku v dané době očkovaných osob, a to zvláště v případě pacientů s diagnózami a zdrav. stavy s vysokým rizikem těžkého průběhu covid-19“.

jaké diagnózy a zdravotní stavy jsou pokládány za ty s vysokým rizikem těžkého průběhu covid – 19? 

Např.

diabetes mellitus (cukrovka) léčená perorálními antidiabetiky nebo inzulinem

obezita (BMI > 35 kg/m2)

závažné dlouhodobé onemocnění plic (pacient je v péči specializované ambulance nebo je léčen podáváním kyslíku v domácím prostředí)

závažné dlouhodobé onemocnění ledvin (pacient je v péči specializované ambulance nebo je zařazen do pravidelného dialyzačního programu)

závažné dlouhodobé onemocnění jater (pacient je v péči specializované ambulance)

onkologické onemocnění

stav po transplantaci orgánu nebo kostní dřeně a zápis na čekací listině před transplantací

závažné dlouhodobé onemocnění srdce (pacient je v péči specializované ambulance, např. ischemická choroba srdeční, chlopenní vada, kardiomyopatie)

vysoký krevní tlak léčený dvěma nebo více farmaky

závažné neurologické nebo neuromuskulární onemocnění či stav po poškození míchy postihující dýchací systém

vrozený nebo získaný kognitivní deficit, vývojová porucha chování nebo porucha mobility, která významně ovlivňuje schopnost pochopit a/nebo dodržovat nastavená protiepidemická opatření, např. nošení roušky, dodržování 2 m rozestupů apod.

vzácné genetické onemocnění se zvýšeným rizikem závažného průběhu onemocnění covid-19

léčba nebo onemocnění závažně oslabující imunitní systém (pacient je v péči specializované ambulance)

osoba pravidelně a dlouhodobě pečující o osobu z jedné z výše uvedených kategorií

Izolace – karanténa — změny od 1.3.2021

Od 1.3. se mění délka a podmínky izolace a karantény takto :
IZOLACE – nařizuje se u toho, kdo mám pozitivní test
– 14 dní od pozitivního testu
– ukončuje se bez testu, osoba musí být v době ukončení 3 dny bez příznaků onemocnění, izolaci ukončuje lékař na základě konzultace či vyšetření
Vysvětlení: ukazuje se, že tzv. britská mutace viru se na sliznicích udržuje až 14 dní a člověk je tak déle nakažlivý
KARANTÉNA – u toho, kdo byl v kontaktu s pozitivním člověkem
– 14 dní od posledního kontaktu s covid + osobou, po kontaktu ve společné domácnosti počítáno od data + testu člena rodiny (počítá se den odběru, ne výsledku)
– 14 dní po kontaktu ve spol. domácnosti s covid +, kdy se nejde úplně oddělit
– musí být aspoň jeden negativní test v době karantény: 5.-7. den PCR (do 10. dne) a celou dobu žádné příznaky, v případě pozitivity testu se karanténa prodlužuje o 14 dní od testu
– výjimečně, pokud nepodstoupí osoba v karanténě test lze ukončit po 14 dnech, je-li celou dobu bezpříznakový průběh a nelze objektivně zařídit testování
– do karantény nenastupují osoby očkované proti covid-19 (14 dní po 2. očkování, nebo u jednodávkových vakcín 14 dní po této dávce) po kontaktu s covid +, nemají-li příznaky
– do karantény po kontaktu s covid +nenastupují bezpříznakové osoby, které prodělaly laboratorně prokázanou infekci covid-19 v době 90 dnů od pozitivního testu (nutno doložit)
odkaz na tiskovou zprávu ministerstva zdravotnictví
https://koronavirus.mzcr.cz/izolace-a-karantena-kvuli-covid-19-se-prodlouzi-na-14-dni-vlada-se-zabyvala-take-pripravou-novych-krizovych-opatreni/

IVERMECTIN – NADĚJNÁ LÉČBA COVID19

Ivermectin je lék, který se v medicíně užívá už 40 let. Byl vyvinut jako účinný lék proti parazitům, ale funguje i proti virům. Jako nadějný lék v terapii infekce COVID 19 se používá s dobrými zkušenostmi už od dubna 2020. Desítky studií na tisících pacientech potvrdili především bezpečnost tohoto léku. Mnoho studií potvrzuje i dobrou účinnost. Chybí nám ale dvojitě zaslepená randomizovaná studie, která by potvrdila, že je účinnější, než placebo.  Otázka je, jestli se takovéto studie vůbec dočkáme. Virus neustále mutuje a studie z minulého roku pracovaly s virem, který útočí na nižší věkové skupiny. Některé studie zvolily špatný design, např. nasazovaly IVM až 7 den trvání nemoci, nebo v nich podávaly IVM jednorázově. V těchto studiích nebyly výsledky valné stran účinnosti, ale všechny potvrdily bezpečnost IVM.

MZČR  schválilo možnost experimentálního podání IVM, ale pro všeobecné praxe to podmiňuje odběry jaterních testů před a po podání léku, podepsáním informovaného souhlasu a hlášením podání IVM na SUKL.

Jinak se dá už sehnat i ambulantně na předpis, ale zatím za naprosto nehoráznou cenu 2500,- za 30tbl á 3mg.

Přidávám pár aktualit stran dávkování (děkuji svému kolegovi ze Slovenska, který má už s IVM zkušenosti)

Dávkování: obecně platí, podávat IVM s jídlem, nebo hned po něm, výrazně se zvýší koncentrace v séru a v cílových tkáních. U pacientů, kteří zrovna trpí průjmy, je dobré tabletu rozdrtit, aby se stihla vstřebat a podat aspoň s banánem, rýží, či kaší.

IVM je lipofilní, proto u obézních pacientů hrozí poddávkování;  je tedy vhodné podat 1., nebo i 2. dávku 0,3-0,4mg Kg a další dny 0,2mg/Kg


preventivně:

0,2 mg/kg 1. den, další dávku za tři dny,  a pak jednou za 14 dní.

 

léčba doma u symptomatologických pacientů:

0,2 mg/kg s jídlem nebo po jídle minimálně 2 dny a maximálně 5 dní

dovolí-li to situace, bylo by dobré na začátku odebrat základní odběry – jaterní testy, CRP, KO. Zvláště ale, když by se stav zhoršoval, hlavně stran dušnosti. Tam je třeba vzít i D-dimery a případně včas nasadit LMWH, při narůstajícím CRP antibiotika.

 

hospitalizovaní pacienti (platí i pro kritické pacienty na JIP a ARO): 

0,3, mg/Kg s jídlem, či po jídle 1x denně 5 dní. Plná dávka je tedy 80mg za 5 dní.

 

V ČR je zatím k dispozici bulharský IVM pod jménem Humevec, dá se sehnat na předpis, ale je hodně drahý a bude ho asi i omezený počet. Slováci mají mnohem levnější Iverzine (7Eu za 10 tablet), ve třetím světě to stojí ještě méně.

Ivermectin existuje i jako veterinární přípravek – pro koně, ptáčky, ale to samozřejmě není pro lidi schváleno a nemohu to doporučit.

Existuje to jako varianta pasta pro koně, např. Noromectin, dá se sehnat přes veterináře, v té pastě je 140mg Ivermectinu, což vystačí pro dva dospělé nekritické pacienty, cena +- 360 Kč. Potom se dá sehnat roztok pro papoušky Sh Ivermectim, např. na stránkách petissimo.cz. V tom roztoku je 10mg v 1 ml a celkově je v lahvičce 100mg – takže také vystačí na plnou dávku i kritického pacienta. Cena 275,-.

 

A jak vlastně Ivermectin funguje?

První mechanismus účinku je ten, že Ivermectin znemožní pevné navázání spike proteinu SARS-Cov2 s ACE 2 receptorem a tím mu znemožní, čí ztíží vstup do buňky. (Tělo tak bojuje od začátku s menším počtem napadených buněk – LOW VIRAL LOAD)

Druhý mechanismus spočívá v obsazení transportního proteinu importin B1 alfa (IMP B1alfa), což zabrání vstupu viru do jádra buňky, kde by jinak okamžitě po vstupu oslabil, či zcela znemožnil produkci Interferonů I a III. (to jsou poslové, které napadená buňka vysílá, aby varovali všechny okolní buňky a ty se na napadení připravily). SARS-Cov2 po dosažení jádra (řídícího centra buňky) dokáže produkci interferonů zastavit a oslabí tak naší imunitní reakci. V tom mu Ivermectin obsazením IMP B1 alfa účinně brání.
(vir se nedostal do jádra buňky a nemohl vypnout imunitní reakci organizmu která vede k jeho elimininaci skrze interferony, CD8, CD4 buňky – efektivní nezánětlivé odstranění viru)

Třetí mechanismus spočívá v blokování (RdRp) SARS-Cov-2 RNA Dependent RNA polymerázy, která je zodpovědná za replikaci genomu viru. Bez ní se sice množí schránka viru, spike protein atd. Ale každý nový vir potřebuje i novou řídící jednotku RNA viru (mozek). Ta se však nevytvoří, protože Ivemectin velmi efektivně navázáním na RdRp tento proces zastaví. Je to mechanismus účinnku i Remdesiviru (vir se namnožil jakožto sterilní mrzák který se nemůže množit dále, protože nemá uvnitř své schránky své RNA).

Čtvrtý extrémně důležitý mechanismus účinku není zaměřen na replikaci viru v organismu, ale na zastavení přehnané zánětlivé reakce organismu a to zablokováním (NF-kB) jaderného transkripčního faktoru kappa B (nuklear faktor kappa B). Neregulovaná zánětlivá reakce je to, co vede k poškození tkání a orgánů. Není-li včas regulována, je v mnoha případech fatální. Ivermectin blokuje vstup jaderného faktoru kappa B do jádra buňky a tím zastaví produkci či nadprodukci zánětlivých cytokininů (IL-6, IL-1beta, IL-18, TNF-alfa). Proto pomáhají NAC, kyselina Alfa-lipoová, GSH, resveratrol a další protože také mimo jiné míří na regulaci NF-KB. Zde by mohl mít i svoje místo Kolchicin.
(Množení viru, poškozené buňky a zmnožené imunitní buňky to vše vede k enormnímu tlaku na spuštění genově řízené zánětlivé reakce. NF-kappa B je spouštěčem kaskády zánětlivých cytokininů vedoucích k cytokininové a následně k bradykininové bouři. Ivermectin blokuje NF-kappaB).

https://www.sciencedirect.com/science/article/pii/S0166354220302011

Kontraindikace: přecitlivělost na účinnou látku, nepodává se těhotným a kojícím, kontraindikací je i těžké selhání jater

Interakce: jediná známá interakce s léky je s Warfarinem, warfarinizovaní pacienti by se na ten týden převedli na LMWH

Nežádoucí účinky: průjmy, bolesti břicha, svědění, nevolnost, bolest hlavy, horečky, závratě, ospalost, ataxie, únava, tachykardie, vyrážky, edém kůže, eozinofilie, zvýšené jaterní testy. Tyto účinky byly popsány při léčbě parazitů, jsou přechodné, zřídkavé, navíc spíše způsobené rozpadem mrtvých organismů.

 

SELINCRO – lék, který pomůže snížit konzumaci alkoholu

Selincro se užívá jednou denně podle potřeby. Může pomoci hlavně kvartálním alkoholikům, kteří si mohou vzít tabletu před očekávaným pitím. Může pomoci těm, kteří abstinují, aby neselhali, pomůže odvrátit rozvíjející se “tah”, celkově pomůže snížit množství vypitého alkoholu. Funguje tak, že se váže na opiodní receptory v mozku a snižuje pocit bažení – craving. Cena jedné tablety je 139,-.